Gene detail

Detailed information of OS493_036819-T1 in Lophelia pertusa

Genomic Location: scaffold_385:168077...190363
NR annotation: KAJ7388591.1, Leucine-rich repeat serine/threonine-protein kinase 1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_036819-T1

ATGAATCACTGCGGTGAGGATAAAACAGCTGAAACAGCTGACTGTGATAGTGTTATCAAGTACCTGTATGAGGCCTGCCAGACAGGAAACCTTGACACGCTATTACAAGCAATTTACTGTAATAATGACATAGCACATCAACTCATTTGTGGACATGAAGCAGCTGATGTCGACCTTACATGTACCTTGCCGAGAAATTTTCTACACATGGCTTGTGAGAATGGGCACTTGGATGTTGTGCGTCAGCTTGTGGATTTCGGAGCAGATGTCAATCAAACATCAGATGAAAACGGAACTCCGTTATGCGTAGCATGCATGAAAGGGCATGCAGATATCGCAACATTTTTGATATCCAAAGGTGCATTAGTGCACGATCCCGCACTGGGTCACTTGTCACCAATTTTACTTGCTTGCAAGTCTGGAAAACATGAAGTAGTGGAATTTTTATTGTCAGAGCAGCCGCAACTTTTAGAGACACACGGACAGTTACTACTTTATGAAGCCTGCAGACTTGGTCATGGCCAGATAGTAAGATTGTTGATCAAGAGACGGGTGGATGTGGATCCTCCTCAAATATTGGCAGCTTCTCAGGCTAGGGTACCAGGGAGTCCTCTTCAAGGTGCTTGTGTGGGTCGTCAGACGGCCATTGTTAATTATCTCATAGAAAATGGCGCCAAAGTGACATGTGACATTGTGGAGAAATATTGGGAACTCGTAGGAGAGGCATTAAAGAGGTACACAAAGGAAACTAAGAACAAAACGAAGACATCACTCTCATTCGAAGTTGATCCAAGTGTCACTATGTTTTCTGCTGCGTGGGGCAAAAAAAACCTGTATGCACTTCACAAGGCCTGGTTTATCAACTTGTCGGCAAGACTTGTTAGTGTTGACCTGTCAGAAAACAACATTGAGGAACTTCCAGACGAGCTATTTAACATCCTGCCTGCGTTAGAAGTGCTTGATGTGTCCAGAAATAAGCTGGAATATTTGCCTGAAGTTGCAAGCACCTACAGCAGAATACAAAAACTGTCTGCTTTTGAAAACGAGCTGACGTTCGTCCCGGCATCGCTACTGCAAATACCAACCTTGAGGAAATTGAATCTCAGCCGCAACAAAATCACATCGTTATCTGGCGACCCAAATGATGACAGCGAAGAAAATGCAAACATGACCGACGGTGAAACATGGGGCTGTACTGCCCTGAAGGTCCTCAGCCTGTCGAACAATAAGCTGCAGTATTTACCGAGAGGAATTCAAGGTGCTGTTGGGTTAACAAAGCTTTTGGTTGACCACAATGATCTACGAGATTTCCCCATGCCTTGGAAATGCCCCTTGGAAATCCTTGATCTTTCCCACAATCATTTTACCCATTTTACCTGCAACATGGAAATGCACTTTGCACAAGCTAAGCTCTCCTACAACAAGCTCTCCGCCAAATCGCTGTTAGATCCTCAAGCTGGTTCTCCAAAACGTTTTCCGTTCTTCAAGACCCCCAGCCAAGAAGACGCTCAAGAAATAAAGACCGAGTGCGAATTTCCTACAACACTGCTCTCCCCGACGCTGGAAACACTTCTTTTAAACGACAACAACTTACAAGTGGTGCCTGTCAGTATTTGTGGACTGATGAGCTTGATCGAGCTTGATTTAAGCAACAATCCTGACTTGCGAACTCTTCCACCTGAACTTGGCAACTTACGCGAGTGCTGGCAACTCCGTCTGAACAAGTTGAATCTTCCAGGCATACCGAAACACGTGAGACCAGGTGAGAATGGTGTTCGACCTAAAGATACCCTGGCATACTTGCGAGCTACTCTGCGCAAGTCTGTGCCGTATTACCGCATGAAACTCATGGTAGTGGGACTGCAGGGTCGTGGAAAGACAACTCTGTTATCGGCTTTGAAAGGTCAGAAGCTGCCACCTAACTTGTCCACTGTAGGAATTGTGATCGATGAATGGCAGGTCCAGGTGTCTTCCAGTTCAAGGTTCACATTACAGCGCTTCTTAGCACAGAGCGATGCGCCATTGATAACATTCAGCACGTGGGACATGGCGGGACAAAACGTTTATTACGCTGCTCATCAAATGTTTTTCTCGCCCAACACTCTCTACTTGGCTGTGTGGAACGTGTTGCATGGCGAAGAAGGAGTCGAGAGTCTCAGACGCTGGCTTCTCAACATACAGGCTCGCGCGCCCTTTTCCGAAGTTGTAATCGTCGGAACACACCTCGACTTGCTCCCGAAGAAGAACCGACAAGCCCGCGTGGATGCACTCAAGCATAGCATCGCACTCAAGTATCTCGACAACCAAGGGTTTCCGAGGATTGTCGGAAATATTACAGTGTCTCCGACGACTGGCGAGAACATCCCGGAATTGAAGGAACTGATTTACAGCAAGGCGCTAAAAGTCAAGGACCTTGGAGAGAGCGTCATTGGTCGGAGGGTACCACAAAGCTACACAGACCTTCAACAAGCCATCATACAAGAAGCCGAGCGACGCAGATCCACTGGTGAACCGCCGATACTCTTGGAAGATGAAATCTTGCAACTCGCCAAGTCAAGTCCTGAGAACGACATCTTGGACACTGAGGAACTGACGTTGGCCACCAGATTCTTGCATGAGAATGGCATCCTACTTCACTACAACGATCAACTGCGTGGGTTGAACCATCTTTACTTCATCGACCCTGCGTGGGTTTGTGATCTGATCGCCACCCTGGTCACAATCCGAGAGAGAAATCCCTTCGTTTTGAACGGCGTTATGAAGAAGAAGGATTTGGAGTTGGTGCTGAGAGACCCCAAGTTTCCCAAAGATTTTATCCCTCAGTATCTTCAACTGATGGAGCGTTTCGAGATCGCCCTCTCCCTGAATGAAGAACAGCTTTTAATTCCTTCCATGTTGCCAAAAGAAAGACCTGGAATGCAACTTAACCAACTTCAAAAGCTAATCGCCAAGAGAAAGAAACCCGATGAAAAGCTTAAGCTGTCCAGTAGCCGTGGTAGTGCGTACACTCATGCAGTCGACAACAAAAACGTCACCACAGTGCTCAGAAACTACCAGATGGCCTACACACCGAGTGGGTTCTGGAGCCGACTCATTACCAGGCTCATGGTGTCGGTGCAGAGATGGCGCGCCATTGAGCAGATTAAGGAGGAGAGCTATTCCTTGGTGTACTGGCGCGAGGGGATTGGTGTCGTGTACGAAGGAGGACACTTCCAGGTGGAATCGTACAAGGAATTGATCCCTGTGAATCAAGGGAAAGCTGCCTTTCAAGAAATCAACGGCATTGCCATCACTGTTTGGTCAGAACATCGTGACTTTGCTGCTGTGGGATTTATCGTCGATCAAATTGACGCCCTCATCTCCGAGTGGTATCCAGGTCTGGACGAGACTGACATGTACGGGCTGCCATTGGTTCGCCGTTTAATCCCGTGCCCACTGTGCACCAACCTCATGACTCAACGTCATTCGATGAAGCGCTCCGTTTCCATGGCCGAGTTGCCCACCTCTTTTCACGCGGCGTACCCTCCACGACCCTACAACTTCACGCTTCCGACATGCGCAGCGACCGCGCTGAGTTTTTCAACGATCACCTGTCCCTACCACCCTGATAAAGTTGTGTCGCTACAGCATCTGATCCCAGACTTGCTGATGGCGGACTTGCCGCGCCATTTATTGGTGGACCAAGGCCAGTTCAAATTCGAACCGCGGGAATCCGACAGGATCGGCGGCGGTGGCTCGGGCGAGGTGTATCGTGGGACGTACCGAAACGAGGCTGTTGCGGTTAAAACGTTTCACTCTACCAGACAAACCAGGTCTCTCCTGGATAGTGGACTGGGGAATACTGGGCCCGCTGCTGGATCCAGAACTTTAGGTGGGTCTTTCTATCAAAGATCACATCGAAGCGAGGGTTCGAGTATGCGCAGATCAGATGTTTTCTCCACGCTCTCTGAGGATGACATGGAGGAGGAACTGGAGAAGACCAAGTTGTCAAAGCATTCTGGGACTTACGTTGCTGTGCTGTGCCGTCTAAACCACCCGTGTGTGGTCCGTCTTCTCGCCGTGTCCCTGCACCCGCTCTGCTTTGTGTTAGAACTCGCTCCATATGGCAGCTTAGCTTCAGTCGTTGATGAACTTTCGTCGAAACGCGAAGCACAAGAGAAGGACGGTGGTGGAGTGTCCAGGATTAGGGAGTCCATTCTCGGGCGCGAGCTGTCCTACAAAATCGCATTTCAGGTCGCCAGCGCCATTTGGTACCTCCATGACTGTGACGTCATCTATCGGGATCTAAAAGCCGACAATGTGCTGGTGTGGTCATTAGACGAGTCAAGTGTACAGAACGTCAAACTTTCTGACTACGGTATCTCGTGTTTTGCCACACCCCAGGGGGTTGCCGGAGAGGAGGGAACACCCGGGTATCAAGCACCGGAGATTCGTACCGGGGTTGGATACGATGAAAAGGTGGACATTTTCTCCTTTGCAATCTTCGTGTTTGAGCTTCTGTCTGGCTGTCGCCCTTTTCGTGAATATCGCAACGTGGTGGACATCAAGAAAGCAATCCGACGCGGTGTCCGACCCTCGCTTGAATCCTATGACTTAGATACACAGATACCACGACTGGAAGGTCTTATGAGGCAAGAAGATCGTTATAGTTTGACTTCGATCCATTATGACACTCTTGTTATAAAACTGGCATAA

Transcript

OS493_036819-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q3UHC2	Leucine-rich repeat serine/threonine-protein kinase 1 OS=Mus musculus OX=10090 GN=Lrrk1 PE=1 SV=1
Q38SD2	Leucine-rich repeat serine/threonine-protein kinase 1 OS=Homo sapiens OX=9606 GN=LRRK1 PE=1 SV=3
Q5S007	Leucine-rich repeat serine/threonine-protein kinase 2 OS=Homo sapiens OX=9606 GN=LRRK2 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003012 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00560 all species →	LRR_1	Leucine Rich Repeat	Repeat	Interproscan
PF08477 all species →	Roc	Ras of Complex, Roc, domain of DAPkinase	Domain	Interproscan
PF13855 all species →	LRR_8	Leucine rich repeat	Repeat	Interproscan
PF00069 all species →	Pkinase	Protein kinase domain	Domain	Interproscan
PF12796 all species →	Ank_2	Ankyrin repeats (3 copies)	Repeat	Interproscan
PF16095 all species →	COR	C-terminal of Roc, COR, domain	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002110 all species →	Repeat	Ankyrin repeat	Interproscan
IPR011009 all species →	Homologous_superfamily	Protein kinase-like domain superfamily	Interproscan
IPR017441 all species →	Binding_site	Protein kinase, ATP binding site	Interproscan
IPR000719 all species →	Domain	Protein kinase domain	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR020859 all species →	Domain	Roc domain	Interproscan
IPR003591 all species →	Repeat	Leucine-rich repeat, typical subtype	Interproscan
IPR036770 all species →	Homologous_superfamily	Ankyrin repeat-containing domain superfamily	Interproscan
IPR001611 all species →	Repeat	Leucine-rich repeat	Interproscan
IPR032675 all species →	Homologous_superfamily	Leucine-rich repeat domain superfamily	Interproscan
IPR008271 all species →	Active_site	Serine/threonine-protein kinase, active site	Interproscan
IPR050647 all species →	Family	Plant LRR receptor-like serine/threonine-protein kinases	Interproscan
IPR032171 all species →	Domain	C-terminal of Roc (COR) domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR48056 all species →	LRR RECEPTOR-LIKE SERINE/THREONINE-PROTEIN KINASE-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0004672 all species →	Molecular Function	protein kinase activity	Interproscan
GO:0006468 all species →	Biological Process	protein phosphorylation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_036819-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_036819-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

18.6Max TPM

8.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.42	14.47
polyp at pH7 6	18	18	7.98	13.13
coral polyp · control treatment	16	16	10.20	18.64
coral polyp · oil and dispersant treatment	16	16	9.54	13.16
coral polyp · oil treatment	16	16	7.02	11.85
coral polyp · dispersant treatment	16	16	8.35	14.26
Polyp	10	10	1.82	4.03

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.47
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.97
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.82
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.54
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.39
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.15
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.21
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.02
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.96
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.95
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.39
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.21
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.86
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.80
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.79
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.00
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.30
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.82
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.13
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.66
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.72
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.38
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.80
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.71
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.83
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.42
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.99
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.35
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.19
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.52
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.17
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.06
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.12
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.61
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.58
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.46
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.64
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.94
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.36
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.66
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.51
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.15
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.31
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.26
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.90
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.24
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.28
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.69
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.08
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.69
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.60
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.86
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.16
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.83
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.60
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.41
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.26
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.57
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.09
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.51
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.81
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.44
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.32
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.14
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.55
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.54
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.09
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.26
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.85
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.41
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.20
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.40
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.15
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.25
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.94
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.64
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.07
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.33
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.19
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.91
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.72
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.58
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.36
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.29
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.26
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.61
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.21
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.92
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.59
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.41
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.36
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.25
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.49
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.38
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.38
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.47
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.48
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.28
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.06
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.38
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.03
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	2.83
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.61
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.01
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.78
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.55
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.22
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	1.12
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.67
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.40

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.