Gene detail

Detailed information of OS493_036848-T1 in Lophelia pertusa

Genomic Location: scaffold_386:220932...238163
NR annotation: KAJ7382137.1, hypothetical protein OS493_036848 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_036848-T1

ATGGCTGTGTTACAGGAGGGTGTTGAACACCTTCTAGCGATAAGTTCATCGTCTTCCCAGTCACATATTCCTCCTTTGTGTACAGTTATTGCCAAAAGTGAAAATGTCATACTTGAAGGAGAGGACCGTGAAGGGTTCTTTCATTCTTTTGTAGCATTGTCAGCTCATTATATCGGATTAAATGTTACCCAATGTGGTGCCAACTTGCAAATAATTGTGAAAGCGTGTAAGGTGCTCCTGAAATTTACACTTTTGGATTTAGAGAAGAAAAAAGAATCACACCAGCCCCTTGTAAAGAAACAGCTGGTATCCATTATTGAAGGCCTTTGTAAAGGACATGGCTGCCTAAAAAGAACAGAGATCATCACTCTAACAGCTATCTTGAAATCGGCCAGTGTGCTGAAGGATACAGCCAGTAAACCAGAACAACAGAAAGGTATCTCACTAAGTCAGGGCGATGACTTTTTTCAACGCCTTCAGACAGCATTTACAGAGACTGGAGACAATCACCCAAGCTTCATCAAAGACAAGACCAGGTCAGAAAATGAGAAGAGTTTACCCTCAGATACGAGTAGCACAGATGTTAAGAGCTTCTTCTCCAACTGCAATGTTGCAGCCCTGAGACAGCTTGGAGGTGGAGGAGTGTTGTTAGACTTGTGCCTTTCCTTACCTGAATTTTCAAAGATTGCATCTAAACCAGCTTCATCTTCACCACTGTTGAGTTTAACATCCTCAAGTGTTCAGGGGCTGTCTTCAGAGTTGTTAGTTGTTTCAAGCATAATATCCATCCCAATATTGGAACCACTCTCAGCAAGTCGAGTGGAGAAAGTCTGCCAGCTGGCATTAGGCTGCTTGGACGTTGCTCTCACAATTGCCACAGGAAACTTCAACATTGCTGGTGCAGCTGGAACAACAGGGTTGAGTCGTCCTCTGTCAGTGAAGACATTGCTGGGAAGGTCATCCTTGTCCAAGGCTTCAGGAGCTAAATCTGTCAGCAAAATGTCTGGTGAAGAAGAAAGCCTAGAAAGATGTGCTCAAAGTATTGTAGAGAATAGTATTAATGTGTTTGACGTGATCTGTGGAGTGATATCGTCATCATCTCGAGCAGGAGGACAGGTGTTGCAAAACGTTCACATGTTAGCGGCGCACAGAATAATCCAGGGTCTGCTTCCAGTCTTGGGGCTGACTCCGGAAGACACTTGGTCCAAGGAGAGTGCTGCTTCTAAGTTTAAATGGCTACAAGGTGTGAACACATTAGTGGTTGCACTTGCATCGCGTGGAATCACCCTTTTGTCTTCACTGTTGGACGAACTACAGGTGGAAGGACTGCTCACTGATGCCGAAGATGAGCATATTATCTCTGTAGAATCTGACTTCTCTGTCAATTCTCGTTGCTCTGCTTGGAGGAGAGTGAAGAAGCTAATGGATGATTTACCACTCTTGAATTACCTGTTGGCACAGTTCTCTACTTTGTACAAAATGGCAACTGCCATGATCACCCCCACTGTGTCAGCTGGTCAAGCATCATCTCGTCCAAGTTCTGGAAAATCAGATAGTTCAAAGTCTCCAGCGACATCATCAGATGAAGGCGACAGCGAATACATCTCTTACTCTGATGGCAGTAGTGAAGATGAAGAGTCATTACTTGGTCAGTGGTTTCAAGACACATTATCATCAACACCAGTTGTTACCTCTCAAAGCCCACAAGCTCCGACAAGAAAGAAATCAGAAAGCGGCGATGTAGGAGACAGTGGCACTGAGAGTACGCCATCTGGACGTTCATTTCAGATGGCTCCAGAGGAGTACATCTACCTGGCAACTTGCACTCTACAGTTCTTAACCAAGCATCTACTGAGTAGCCCAGTGTCAGAAATGTCAGAGTATATCAGCCGTTCATTCACAGAGGAGCACATCTCTGGGTTAGTGGGAGTTGTTAAGGATCTGGACCAACTTTCCTTCACCAGCATGTCATGTTATGTTGACATGGACAAGCTCTGTGGCGCCATCGACCAAGCTGTTCACTTGCTCCTAGTTTCAGACTTGTTGTCAAATGATCAACAGGATGTTTTTCTCAGTCATCTTGGCCTGGCACCACTGGATGATGGACCATGGCCACTGAAGGTGAGCCAGCGTTGTTTGGGCATTCTTGCCAGAGTGTTACTGGCCCGACAACAGAAGGCTTTAGAAGCAACAAACACAAACATGGACATTGCAGAATGTGTTAAAGTGTGGAACAGGTTGATAGACACACTCAGAGATAATTCTCTTTTGGAGGAGGATGTTCTTGTCACCCAAGGTACGTCACAATATTCGTCACCAATTATTGATTATCAATATCACTTGAGTCATAAATGA

Transcript

OS493_036848-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5T4S7	E3 ubiquitin-protein ligase UBR4 OS=Homo sapiens OX=9606 GN=UBR4 PE=1 SV=1
A2AN08	E3 ubiquitin-protein ligase UBR4 OS=Mus musculus OX=10090 GN=Ubr4 PE=1 SV=1
Q2TL32	E3 ubiquitin-protein ligase UBR4 OS=Rattus norvegicus OX=10116 GN=Ubr4 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001776 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF19423 all species →	E3_UBR4_N	E3 ubiquitin-protein ligase UBR4 N-terminal	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR045189 all species →	Family	E3 ubiquitin ligase UBR4-like	Interproscan
IPR045841 all species →	Domain	E3 ubiquitin-protein ligase UBR4, N-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21725 all species →	E3 UBIQUITIN-PROTEIN LIGASE UBR4	Interproscan

Gene Ontology

No Gene Ontology signature was detected for OS493_036848-T1. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_036848-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_036848-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

108TPM > 0

7Conditions

18.6Max TPM

5.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	5.39	10.27
polyp at pH7 6	18	17	4.70	9.87
coral polyp · control treatment	16	16	7.81	18.65
coral polyp · oil and dispersant treatment	16	16	7.02	18.03
coral polyp · oil treatment	16	16	5.17	9.93
coral polyp · dispersant treatment	16	16	6.66	13.73
Polyp	10	9	0.91	1.97

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.27
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.57
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.43
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.93
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.68
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.58
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.94
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.73
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.46
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.18
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.99
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.49
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.07
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.73
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.62
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.46
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.50
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.31
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.87
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.09
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.61
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.03
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.01
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.66
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.95
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.65
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.48
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.01
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.34
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.19
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.16
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.99
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.72
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.68
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.19
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.65
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.67
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.40
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.69
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.39
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.04
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.02
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.95
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.01
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.54
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.02
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.25
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.85
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.27
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.10
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.08
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.03
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.56
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.83
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.96
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.93
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.87
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.67
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.74
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.42
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.78
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.32
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.02
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.74
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.52
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.03
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.94
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.93
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.92
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.75
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.20
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.95
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.94
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.44
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.15
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.94
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.62
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.33
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.94
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.00
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.54
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.37
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.66
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.73
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.80
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.57
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.12
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.38
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.21
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.97
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.40
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.35
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.68
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.50
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.25
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.22
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.21
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.18
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.07
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.97
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	1.69
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.36
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	1.11
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.00
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.67
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.47
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.43
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.42
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.