Gene detail

Detailed information of OS493_036850-T1 in Lophelia pertusa

Genomic Location: scaffold_386:243942...258144
NR annotation: KAJ7382139.1, hypothetical protein OS493_036850 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_036850-T1

ATGGAGATAGCACCAGCCCTTAAACACACTCTTTATTCACTGGTTCAACTAGCCGCAGATTTGCTTTCGTGGAGTCCAAAAGAGGAACACTCCATGCAGACTGTCCTTGGTAAACAACTGTGCAATAACATAGTGCCTCTCATGGTGGATGCCACAACAGAGTATCTTTCAGAGCAGTGCAACAGCATCTTAGAGGCAGTCATTGGTCCAGCAGACAGTGACAAATTTGCTAACTGCATTCAGTCATATGTTCTGTCAAAATGTCACAAACTTCTTGTAGACCAGTCGGGAGCTGATAGGTCTGATATTGGTGAAGAGGTGTTAGTAGACTGTCTGAAGTACATGGACTTTTTGTTAGACAAAGTGTCTGACCACACCCTTCTGGATCAGTTGTACTCTAAGAACAGAGAGCTCTGTAAGGTTATTGTGCTCTCAGCAAACAAACGACTGTCTCTGGGATATGTTAACCGGACTCTGAAGCTGTCAGTTCGCTTCTTGCAACTTGCGGAGAAGCCTCTAAACTCCAGTATGCGTTCCCTGTGTTCTGGCTTCTCAGAACTGTGTCATTTAGACCATGCAACCCTTGAGGCTTGGCTAAGAAGGATTATCTTGGGGGTGGAAGAAGACAAAGGAAACACTGGAAAGATGGCAGATAACAGACTTCTGTTGCAGACATTTGCCACTCTCATTGTTAAGGAATCAAGTCCTGTTGGTGAAGAAGTGTGCCGCCCCTTGTTAGAGTGTCTTATTCCCTTGGGAAATGAGCTTCTGCCAGATATCCCTGGAGAGTGGACTAATATTGGGTCCAAATTTGGTGACCTCTTGAACACGGCTGCAGTGTTGGCTGGTGCAGGGGATGGATCAGGGCATCTTACGTTATGTACTGCTGTTATTGAGTGGCTGGAGAAATGTAAAACTCAACTTCTGCTGGTGGCTGAAAATGGAGAGAAAGGAAAGGAAAGTGGCATTGTTGAAGCAGCTGGACCTCTTCTTCGTTACCTGGCAGAGGTGATGACAGCTTTGAAGTACTCATCAGAGAACGAGTGTCCTCCTTCACCATCGCTGTGCCCTGTTGATGGTGATTCATTACTGCCAGATGTAATGTCTGATTGGATGGACGACATGGGTGGAGACGAAGAGGATTCTGGCGGAGAGGAGTCAGATGAGGATTCTCTTTGCAACAAGCTATGTACATTCACAATGACACAGAAAGAGTTCATGACCCAACACTGGTATCACTGCCACACTTGTAAGATGAATGATGGGGTGGGTGTGTGCACAATATGCGCTAAAGTTTGCCATAAAGACCATGACATCACATATGCCAAGTATGGTTCATTCTTTTGTGATTGTGGAGCTAAAGAAGATGGCAGCTGTATTGCCCTAGTGAAGCGTACACCTAGCAGTGGGGCAGATAGTCAGGGTGCTGTTCCACCATCACCATTTGTCGCAGGAGAGATGGACGAAGGACAGGATGACACAGAAGGCTCCTCAGGTGGTAGACTACCATCATCAGCAGCTGGAGCAAGCTCATCTGTGGCAGCTACTGCAGCTGGGTTAGCAGGTTCAAGTGGTGCAGGAAATGGAGGTGGACTTGAGGACTCTGAAGCATTTACATCCAAGTCTGTGGAAGCCTTGGCCAAGCAGCTTGAGAAGCACAAACAGCAGTTAGTAAGCCAGTTGGAGAATTCATCAGTGATAACAACCACCCTGGATCTTCTTCAGTGGCTGATGGAGCCTGACGCAGGAGGACCCAGTAGTATTGGGATGGGTGTGTCTAAAGCTATCAAGGATGCTTTGACAGAACTGCATGCAGCAGAGAAAACTGTAGAAAACACTGATCAGCTTATGGTTCCAACATTAGGATCTCAAGAAGGAGCTTTTGAGAATGTGCGAATGACATTCAGTGGAGAGCAAGGACAAACCATCCGGCAGCTGATTGGTGCTCATGTCCTGAGGCGCGTGGCCATGTGTTGCTTGGCATCACCGAAGGGACGCAGACAGCATCTTGCTGTTAGCCATGAAAAGGGCAAGATTACAGTTCTTCAGCTGTCAGCACTCTTGAAGCAGGCTGACTCCAGTAAGAGGAAGTTAACCCTTACCCGACTTGCCACAGCCCAGGTACCCTTCACAGTTTTGTCTATCTCAGGTAATCCTTGTAATGAGGATTTCTTAGCAGTGTGTGGGTTGAAGGATTGTCATGTGTTGACATTCAGTAGTTCAGGGTCTGTGGTGGATCACCTTGCACTTCATCCTCAGCTGGAGAGTAGCAATTTTATCATCAAGGCTGTGTGGCTTCCTGGATCACAAACACAATTGGCTCTTGTCACTGCTGACTTTGTCAAGATTTACGACCTGTCTCAAGATGCACTGAGCCCTCTCTACTACTTCCTGCTCCCAAGTGGAAAGATCAGAGATGTCAGTTTCATCTTTGACGATGGAGATCACAGTTTGATACTCATGTCTTCAGGAGGACAGTTGTATCTTCAGCCCATGGATATCAACAGCAGTGCAGTGAATGGCCCTTTTTATCTGACAAATACAGTTCCCATTGAACATGCTGATCTACAAGACTCCAGTGGCCAAGTGGCTGGTGGAGGAGTGTCTGTATACTACTCTCACATTTTGCAGTTGATCTTCTTCAGTTACAGTCAAGGAAAAACATTTGTAGCTCCATGGAGTAAAGACCAAAAGGAAGTCAAGACGATGTTTCCAGTGACCTTTAAGAGTAGTTCAGGCAGCACTAAGAACTCACAGTCGGCAGCCTTGTGTCAGTGGAGTGAGGTACCACAGCATCCTGGGCTAGTGTGTTGTCTGACACACACAACTGGTGTCCCTGTGGTGCTGATGATCAAGCCACATCAAATATTGATTCAAGAGATCAAAGCAACATCATCCAAAGCAAAAACCCAAGACATGGTAGCTATCCGCCATTCTGTCAGCACATCTGATCAGCAGCGTACCACAATGATTCTTCTTTGTGAAGATGGTAGTCTCCGTATTTTCATGGCCAGTGCTGAACATACTGGATACTGGATGGCTCCTGAGTTCCAACCTGTGAGGCCCCTCAGTATAGTGAAACCAGCTCGTAAAAAGAAAACCACGAAAGCCAGAGTGAAATCCACCACTGTCAGTTTGCCAGTTGATTTTTTTGAGCACTGTCAGCCACTTATAAATGAAGTAGAGTTTGGAGGTGGAGACATCCTGCAAGTTTATAACGTGCAGCAAGCAAAACACAGACTCATGACTGCTGGCATGTATATTGCAAGTACAAAGCCAAATGGTTTCAACATTGAGATCAGCAACTCTAACCCCCGTGTTGTCATGGTTGGAGTGAGAATTCAGATTGGCTGTCAGTCGGTGGAGAAGGCACCATCCTTTGTGGAGATTTTTGGGAGAGTAATTCAGTTGGTAATAACAAGAAACAGATGGGTTGATCTAGCATTTACAAGAGAGGAATCATTATCTGCAGACAAGAAATTCTCCTTGTTCATTGGCCAGTCTCTAGACCCTTCAGGAGTGACCATGCTTGATTCAGTGAAGGTATACACCAAGACAAAAGAGGCATTTGGTTGGCCTGATGATCCCCAGGAAGAGATACCTTCCACTCCTGGCCTGGGAACTGCAGCTGCTGTGGACACAGAGACAGAGATTGTCAACTCTGTTCCTCCAATGACAGCTGTTGACAAACTGGTAGTTCACCTGCTGGAGGTAGTAGATGGTTGCTTTTCCACCTTTTTGTCCTCAGGAAGAGGCACCAAGACAGTCAGCGCTTGA

Transcript

OS493_036850-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5T4S7	E3 ubiquitin-protein ligase UBR4 OS=Homo sapiens OX=9606 GN=UBR4 PE=1 SV=1
A2AN08	E3 ubiquitin-protein ligase UBR4 OS=Mus musculus OX=10090 GN=Ubr4 PE=1 SV=1
Q2TL32	E3 ubiquitin-protein ligase UBR4 OS=Rattus norvegicus OX=10116 GN=Ubr4 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001776 (this species only)
Ubiquitin family	E3\|E3 activity\|UBR-box · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF19423 all species →	E3_UBR4_N	E3 ubiquitin-protein ligase UBR4 N-terminal	Domain	Interproscan
PF02207 all species →	zf-UBR	Putative zinc finger in N-recognin (UBR box)	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR003126 all species →	Domain	Zinc finger, UBR-type	Interproscan
IPR045189 all species →	Family	E3 ubiquitin ligase UBR4-like	Interproscan
IPR045841 all species →	Domain	E3 ubiquitin-protein ligase UBR4, N-terminal	Interproscan
IPR047509 all species →	Domain	E3 ubiquitin-protein ligase UBR4-like, UBR-box	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21725 all species →	E3 UBIQUITIN-PROTEIN LIGASE UBR4	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0008270 all species →	Molecular Function	zinc ion binding	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_036850-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_036850-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

26.6Max TPM

9.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	9.31	14.94
polyp at pH7 6	18	18	8.69	15.65
coral polyp · control treatment	16	16	13.45	26.62
coral polyp · oil and dispersant treatment	16	16	11.46	18.81
coral polyp · oil treatment	16	16	9.33	17.81
coral polyp · dispersant treatment	16	16	10.53	20.76
Polyp	10	10	2.80	4.61

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.94
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.63
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.83
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.13
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.29
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.05
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.47
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.40
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.50
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.46
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.72
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.58
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.57
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.26
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.91
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.88
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.85
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.08
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.65
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.52
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.99
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.69
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.17
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.16
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.33
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.99
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.98
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.47
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.36
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.49
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.67
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.30
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.71
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.52
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.75
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.71
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.62
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.94
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.25
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.76
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.25
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.75
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.68
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.69
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.32
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.98
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.57
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.55
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.52
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.35
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.31
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.61
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.81
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.68
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.80
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.40
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.77
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.89
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.83
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.81
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.18
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.83
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.48
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.67
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.48
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.31
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.75
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.72
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.81
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.64
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.61
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.32
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.35
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.35
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.22
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.65
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.30
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.94
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.34
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.32
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.53
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.09
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.53
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.35
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.76
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.42
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.24
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.19
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.14
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.57
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.19
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.00
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.85
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.09
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.04
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.48
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.01
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.45
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.50
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.55
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	4.61
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.56
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	3.52
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	3.51
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.41
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.24
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.02
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.77
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.69
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.67

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.