Gene detail

Detailed information of OS493_037043-T1 in Lophelia pertusa

Genomic Location: scaffold_397:34128...67483
NR annotation: KAJ7388526.1, WD repeat-containing protein 35 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_037043-T1

ATGGATGAAGCCATTCCTACATCTCTAAACTGTTTACAATTAACTGATAACCATGTTCATATACTTGAGCAAAAGATTGCTATACCAAATAACGTCAGACTGAGATGTTTGGCTTGGAATCGGGAACAGGGATATATAGCTTGCGGTGGAGAGGATGGATTAGTCAAAGTCCTCAAGTTAGAGACGCAGCAAGGAAAAGATGCAAAAGTGAGAGGGCTTGCTGCTCCAAGCAATCTGTCAATGAACCAAACCCTTGAAGGGCACACCGGTGCCGTACAGGTAGTAACATGGAATGAACACTTTCAAAAGTTGACCACCAGCGATGAGTATGGTCTTATTATTGTTTGGATTCTCTACAAAGGGTCATGGTATGAGGAGATGATCAACAACAGAAACAGGAGTGTTGTGCGTGACATGAAGGGAACGCAGATGGTCAGAGAATCTGCATTGTATATGAAGATGATACCTGAAACATGTGCTATGTACTACACAGATCCTGTCTTGATTGACACTTCAATGGCTGTAATGAACATACAGTGGAATAACTGCGGATCAGTGTTAGCTGTTGCTGGTGTACAGAAAGCCACTGGACAGGACAAGGATATAAATGTTGTACAGTTTTATACCCCCTTGGTGAGGCATCTGCGAACACTCAAAGTCCCTGGAAAACAGATCATGCAAGCCTGCTTTGAAGGTGGGGGACTACGCATTGCCTTGGCAGTTGATTCCTTCATCTACTTTGCCAACATCAGGCCCAACTATAAGAAATATGTGAAGTATGTGCGTAACTTGTTGTCGATCACATCATGTGGAGAGCATTGTGTGTTGGCCACAAGGGCAGATGACAGTAGTGGACAGCATGTCCTTGTTCTTTGTAATGCCATTGGCACTCCATTAGACTCCAAGTATATTGAAATTGAGCCTCTTTTTGTGGCCATGACTCGAAGCCATGTCGTAGTTGCATCCAAGGAGGCCTTTTATTCGTGGCAGTATCGCAGTCCAAAGAAACTCACCGCCCTGGAACTGCAGACTCATTCTAAAAGAAAAGATGTTAGAGAAAGAATGTTTCATATTGATGATGTGCCATCAGGAGCCGGAGAGGGCATCAAAGATGTGAGCAAGGCTCTAGCGCCGACTCATGATCCAGTGTGTTGTATTTGTGCTTCGGATAAACTTCTGATCTTGGCACCATTCACCGGATACTCGTTACCCAAGCTTGCCTTGGAAATGAAGAATGTGCTCAACTGCCGTCCACACCAGCTGTCACTCAACTGCATCTCATCGCGCTTGGCTATCATTGACATTTCCGGAGTTTTATCATTCTTTGATTTAGATGTCAAGAAGACAGATCCATCAAGGAATGAAACAGTGGTCGGTGAGCATCTGAAGTTTGAGAGGAAAGATGTATGGGACATGAAGTGGGCAGATGACAATGCAGAACTGTTTGCAATGATGGAGAAGACAAGGATGTACATATTCCGTAACCTAGACCCTGAGGAACCGATTTTAAGTTCTGGTTACATCTGTCAGTTTAATGACCTGGAAGTGAAAGCTGTATTACTGGATGAGATCATGAAGGATCCAGATCACCCAAACAAAGAAAATCTGATCGACTTGGAGGTTAAGTCTTTGCGAGATGCTGGTGATCTGTTGGAAAAAGTTGGCATTGCTGATGCGTACCAGTTCATCGAGGATAATCCTCACCCAAGATTGTGGCGTCTGTTGGCCGAGTCGTCACTTGAAAGACTGGATCTAGAAGTAGCAGAGAAGGCTTTTGTTCGTTGCCAGGATTATCAGGGAATCAAGTTTGTCAAGAGACTCACTAAGTTGGACAATGAAACCAAGAAGAAAGCGGAGGTTGCTGCATATTTCAAGCGGTTTGAGGAGGCAGAAAGACTCTATTTGGAAATGGACAGAAGAGATCTTGCTGTTGACTTGAGACTGAAGCTGGGAGACTGGTTCAGAGTTGTTCAACTCCTAAAGACCGGAGGGGGAGGGGGCGATGACCAACTTTTGGAGCAGGCCTGGAACGCTATCGGGGATTACTACGCTGACCGGCAGAAATGGCAGAACGCGGTCACATATTACGTCCAAGGAAGGAACCAAGCGCGTCTGGCCGAGTGTTATTATATGCTGGAGGATTATAATGGCCTGGAGAAAATGGTCAACACACTACCAGAAAATCACGTCCTGTTATCGCAAATTGCTGGTATGTTTTCCACAGTTGGTATGTGTGAGCAGGCAGTAACAGCTTTCACCAAGACAGGAAAGGTGAAAGAAGCAATTGACTGTTGTGTTCATCTTAACCAATGGGATCAAGCCATTGAACTGGCCAAGCAGCATAACGTCAAAGAGATTGACACTTTACTCGCTAAGTATGCTTCATATCTGCTGGAAAAGAACAAGACTCTGGACGCCATTGAACTGTTGCCTATGGTTGAAATGGCAGATGCCAGAGACAAAACCCACTTCGTGCTCAAAAAAATGTATACGTTCCTGGCAGCTTACTGCGTAAGGGTTTGCCAAACTCGGATCATTTTATCCATACCGGCTTTGCCTACAGGGGTAGGTTCAAGTAGGTCGCAGTTGATTAGCTACGCTTTTATTGTGCGTTAA

Transcript

OS493_037043-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A6N6J5	WD repeat-containing protein 35 OS=Rattus norvegicus OX=10116 GN=Wdr35 PE=1 SV=1
Q9P2L0	WD repeat-containing protein 35 OS=Homo sapiens OX=9606 GN=WDR35 PE=1 SV=3
Q8BND3	WD repeat-containing protein 35 OS=Mus musculus OX=10090 GN=Wdr35 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002339 (this species only)
Ubiquitin family	UBD\|Other\|Beta-prp · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00637 all species →	Clathrin	Region in Clathrin and VPS	Repeat	Interproscan
PF00400 all species →	WD40	WD domain, G-beta repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001680 all species →	Repeat	WD40 repeat	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR039857 all species →	Family	Intraflagellar transport protein 122/121 homolog	Interproscan
IPR000547 all species →	Repeat	Clathrin, heavy chain/VPS, 7-fold repeat	Interproscan
IPR011990 all species →	Homologous_superfamily	Tetratricopeptide-like helical domain superfamily	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12764 all species →	WD REPEAT DOMAIN-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0030991 all species →	Cellular Component	intraciliary transport particle A	Interproscan
GO:0035721 all species →	Biological Process	intraciliary retrograde transport	Interproscan
GO:0060271 all species →	Biological Process	cilium assembly	Interproscan
GO:0061512 all species →	Biological Process	protein localization to cilium	Interproscan
GO:0097730 all species →	Cellular Component	non-motile cilium	Interproscan
GO:1905515 all species →	Biological Process	non-motile cilium assembly	Interproscan
GO:0006886 all species →	Biological Process	intracellular protein transport	Interproscan
GO:0016192 all species →	Biological Process	vesicle-mediated transport	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_037043-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_037043-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

32.1Max TPM

9.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	9.68	17.13
polyp at pH7 6	18	18	8.44	13.64
coral polyp · control treatment	16	16	12.96	32.07
coral polyp · oil and dispersant treatment	16	16	9.91	23.86
coral polyp · oil treatment	16	16	12.06	19.66
coral polyp · dispersant treatment	16	16	8.74	20.04
Polyp	10	9	5.10	11.69

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.13
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.05
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.70
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.95
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.68
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.62
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.13
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.99
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.05
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.65
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.38
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.73
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.62
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.47
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.22
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.21
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.93
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.82
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.64
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.52
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.95
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.24
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.96
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.92
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.47
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.36
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.30
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.78
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.77
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.51
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.39
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.86
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.78
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.02
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.01
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.46
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.07
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.31
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.91
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.46
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.42
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.36
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.49
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.82
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.87
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.96
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.81
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.76
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.93
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.52
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.92
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.72
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.86
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.54
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.28
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.71
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.93
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.64
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.85
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.31
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.24
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.17
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.10
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.89
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.66
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.07
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.69
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.56
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.66
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.13
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.69
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.94
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.93
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.53
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.25
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.12
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.37
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.21
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.09
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.78
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.45
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.39
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.20
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.13
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.04
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.26
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.27
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.08
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.87
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.92
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.47
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.73
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.98
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.98
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.54
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.45
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.09
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.93
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.42
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.85
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	11.69
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	10.76
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	8.59
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	6.76
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	4.97
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.63
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.69
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.48
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.41
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.