Gene detail

Detailed information of OS493_037046-T1 in Lophelia pertusa

Genomic Location: scaffold_397:96654...154006
NR annotation: KAJ7388529.1, hypothetical protein OS493_037046 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_037046-T1

ATGGCGAGCTCTAGTGCTATGAGCGAGAAACTCGCGCCGATTATGGCGACGTTGATGGCAAGACAAAATCCGGAAAGTCTTAGTACACAAGAACACCACACATCAGCAAACCAAATGAAGAAACTTCTTTGTGAGTTCATCAATAGCATATTGACTGATCTTGATGCAGTTGCTGCACAGTTGTCACGGAAGACGGGAGGTACGCCTCATTCAGAGAGCTTTTGGCAATTCTTACATCACTGCCTTGATGCATTCCCAGAGTGCTTTGTGAGTTTAGAGCCCCAGAGTAACCACGAGGGCATGCCTGTCACGAGCACGTCTCATGGTACAGCTGCTCAGATACAGGGAAACAAGATCTGCAAATCAGGGAAAGTGTTTACATCATGGATCCTTTCTAGGATTCTCTGTGTTCTTGCCGAGCCAGACTGTTCCCTGTTACATGACAAGTCTATTTCAGCCATTCTTTCATTATTGCAGCTAGTGAAGGGAAAAGATCTCGTATTTTACAACAAGTGCCTCAAGGAATTTGTTACAATTCTGGAGGATCTAGTAACTGTAGATGAAACATTGTTGTCCTTGCATTCTCCTCCTGTTGAAGCCTTCCCACTCTACCTCGGACATTTTCAGTTTACAGAAAGTTGTGACAATGAGAAGGAGCTGAACATGGTAAAGAAATTGATGTGTATAAAGCATGCAGAAGATCGATATGCTTTACAAGAAGCAGTAAGTAAAATCATCAGCCATGTGATCAGTGATGTTTACCAGTTTGCCCAGAGCAGTGTGGCAAGTTTATGGATAATTTGCTGTCAACTTCTGCGGACTGGTCTCCTGCGTATTAAACAGACAGCACTAGACATCATGACTGGCTTGTTGCCTTGGAGTGGACTTCCCAGAGTACCTGTCCTGGACCAGTTTGTCAAGTGTCTTTGCTCTTTGTTAGAGTTATTGGTGTCTGGAGTTGCCGCTAAAATACCAGTGAATGGAAGAGAAAAAGTCACTACTTTGGAGGTCAGCATTGCTAAGTGTTTAGAAGTCCTTTCAAGAGATCTTTCAGCTAGGGATCATTCTCAACACACAAGCTCAACATCAGAAGGACTCCTGTATGTCTTTCCCTCATGGCATGTCAATCATTTTCTATTGAAACTCAGAAGTACACTCCATGGGGGTGGCCTACAGAAATTTCTTACCAGAGAACTGAAGAGGGCTGTCTGCCAGTTTGTTGCCCATATATACAAGAATGTACCAATCAACACTGGATGCACAGTTCTTTCATCGCAATGCAATGTCAGAGATGACATCAATGAGTGCCTGGTCAGTTACATTGGCAATGAACAAGAGCAGCAGTTCTTGGTTAGCTGTTTATGCGAGGCAGTAAATGTCGAGATCAGAACCAACAGGAAAGCTACTGTCAGTAGCAAGTCTCTTCAGCTTACCACTTTGGGGATGGATCCAGGACAACCAAGTGCAGGGATGATTGAAAGCAAGAGCAGGAAGACTCCAAAGAAAAGAAAAATTCTCACAACCTCACAACCTCCGCTGCCAGTCAAAGAGGAAAGAAAAACTGCTCTTTCAGTGACAATGGCCAGATTGTTGGAAAGATTCAAAGTCCTTAGCAGTTCTGTACTGCAGAAGGCAAATGAAGTGTTGCCACATTTGGATGAATTTATTTGTGAACTGGAAGGGATAAGAGTGATTACAGAGCTGATGGTTCACCTTTGTAGTCGCCAGATGAAGAACTCCAGTGGTGAGAGCCCAAGTGACCTAAGTGAAATTAAAGACTTTTTTACAAGCTTGGATCTGACCCACCTCTTCTCAGTGCTTAAAACATCACTACAAATCATGGTTCAAATTGCTGAGCAGTCACCACAAGGCACAGACACACGCAACATCCTCGATTCATCCTTTAAAAAACTTGTTCTGATTTCAGGAGCGCTCTACTCCATCTCAGATTTAATTCATATACCATTTGATTTATGCCAATTCTTGATATTTTTGGTGTCTATTCATTGGCTGTCACAGTGTGATCCTCCCTGGATTGATCTGCCCCGTGGGTTTGGCCTGCCGATTGATGGTATGGCCAGGGTAGGGAGGTCACTTGGTCCTGTGATTGGCAAAGAGAGCCAGGCTGTATGTCTTCATTTGCTGGCAGTATTGGATGCCGCACCAACATGGAGAACACAAGTTTTCCTGTTAGTTTTGAAGGATTCTACCTTTGACACAAAAATAGCGGCACTAAAATGTCTGCCTCTGTTACTGTCCTCTCTTGGTTCATTCTCATTTCACTTGATCACTGAATTTCTTCCTGGGCTTCTGTCCTGTTGTGAAGCTGTTCAGCACGAGATTGCCAAGGTCATTGGCTCATTAGCATGTGTACTTACAGAGAATACAGTGATAAGGAAGTTGAAGGAGGAATTGTCTTTTGATGATCCTGTTTGTAGCAGCATCACATTTATCTGCCCTGATTGTGATCGTAATCTTTCAAACAAAGCAGGTGATGGAGAGGAAAACAAAATTCATGCCATAGTGAATGCTGCCATATTCACTCAATACCTACAACTTCTGTCTCCCGATACAAACTCATCCATTAAATGTGCCTTCATTAATAGCATGAAGAGAATTTTTACACACATGGCATTTACACCCGACAATGCAGCTCATAGTTCTATTGTTAGTGCGACATGCTTTGATCTCATTGAGGACCCAGACTTTGATGTCAGAATGTCTTTCAGCAATGTTGTACCCCACATTGTCAAGCCTGGGGGAGCAGACTCAAATGACAACATGCAACAAACTGTCATTTCCAAGTTGAAGAAAGTGTTTGTTGAAGCGTCCTCACAACGCAACCACAAACTGCAGGAAACGGTGGTTTTAACAATTGGACAGTTGGGAAGAATTGCTGAGGGGGAACTGCTGCTGGTCGTGATTGTGAGTTTGTTGGAAAGCCTGACTGCTCACTCGCAGCTTATAAGAGCCATTGCCTTCAAACAGGTCCAAGAAGTGGCTAAGTTTCAGGGCAAACAACTGAAGGATTTGTTTGCTGGGTTTAAGCAGTCCATTTGTAAATTTGTAGTGGATGCAATTGATAAGATACAGAGCCAGAATCCTGCTGCTAAGGTGTCTTTAGATGTCGTCTCAGAGGTTGCCAGTGTGTTTGAATTCAGGGATGTCCACTCCTTTTTGAAGAACACGTTACGTTTTGTCATCCCTTACCTGGTCAAGATAGCCTCACCTTCTTCATCGGCAATCTTGCGGCATATTGCCAAAGAACTGAAGATGCACAGACGAGAAATGCTACTGGAAAACTTCAAGTACATATTCTCTTTCCTTGTGAGAACGTGTTCACCATCTGAGCTAGAGAAAGCTCTTGGTTATGTGCAGAAAGAGACAGATGTAGAGCTTGGAAGCCTGTTAAGATCAGAGGCGCAGAGTGTTTACAACCAGCTGTTGTTGTATTTAAGTGTCAGTTATAACAAAGTGTTCAGTGGACTGGCAATGCTTGCATCAAAGGATGATACATACACTGGGCCAAAGGATCTGCAAACCACTCAGCATCTGGCAAATTTTCTGCAATCCAGGTTGCTTGGCATCCTTGCTTTCTACAACACTGTGCTGCTAACGAACACTGATTTGGAAGAAAAGAGATTAGCTCTAGAAAGTCTCACTAAGCTCATGCAGGTGATGGGGCGCAAGTTCATAACCACTGTACGCGTCAAAGTCATGGGCATCCTACGGCTGTGTCTGAGATTCCAGGACAAAGGGTTCCCAGAGCTGTCATGTGATGCATGGGAAAGCTTTGTGCGAAACGTAGAGCTTTCAAGCCTTGGTCCCATGCTGAGTCAAGTCGTCGTTACCCTTTTGCCGTACTTGAACAAACTTCCAGCAAGAGTTACCCAGATTTTCCACTTTCTGATTGTAGAAAACAAAGCATCTTTGCAGGAAAATTTTCATGAGATCTACTTTCTACCTGACATCCCAGAACTTCGTAGAGTAAGTGCTGTACTCAGGTCTTGCAGTGGAAAAGCTTCTAAGAATATGGACCTGCAAGCCCAGCTACGACAGTCTCTGAAGGGGATTTCTCACGAAAGTGCTGATGTGCAAAGACACGCTTTATCAAAACTCAAACAGTTACTTCATGATAACCAGGCCACTCTGCACGGCTATGTCCTTAGCAATGAAACGGTCAATCCTATCATCCCACAGCTCATTAGTGTGCTCATGTCCAGCTGTCGTGAAACTGATTCTGAAGCTAAGATACTTGTAGCTGAATGTCTTGGTGAACTGGGTGCAGTTGATCCTGGAAGACTGGATAAGCTGACACATGATCCTGTAGATGAACAGACAGTGTTTGAGAGTGGTTGCGATGATATGAAGTTTGCTGTTGAGCTTATTAATCAACTAGTTCAAGCATTCCTGGCTGCACATGATACGAGAGCACAGGATTGTTCTGCATATGCTATCCAAGAAGTACTGTTAACGTATGAATGCAGTGAATCTAAGAAGGATGGCCTATGGCATGAATTTCCAGAGCATATCCAAGAAGTCCTTAGACCACACTTGTATTCAAAATACCTTAGCTCTACCACACCAACTGGTCTCGCCTTCCAAAGCCCATCTACAGGAGTGCAAGGGGCAGAGTTTTCAATGAAATGGGTCAGCACATGGACGTCATATATGATCACTAAGGTTAAGAGCAAGAAACCATCTCACATGTTTCAGGCTTGCAGTAAGATTTTTAAGCATGATGTCAAGACTGCGTTGTTCCTGCTTCCTCATGTGCCTGCAGTATGTGCTGTTAGATGGTACACAAGAAGATGTCGAGGAGGTATATGTAGAGATCATGGCAGTTCTTACTCATCTGAAAAGAAATGA

Transcript

OS493_037046-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9DE14	Serine/threonine-protein kinase atr OS=Xenopus laevis OX=8355 GN=atr PE=1 SV=2
Q13535	Serine/threonine-protein kinase ATR OS=Homo sapiens OX=9606 GN=ATR PE=1 SV=3
Q9JKK8	Serine/threonine-protein kinase ATR OS=Mus musculus OX=10090 GN=Atr PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002085 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF08064 all species →	UME	UME (NUC010) domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR011989 all species →	Homologous_superfamily	Armadillo-like helical	Interproscan
IPR012993 all species →	Domain	UME domain	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR050517 all species →	Family	DNA Damage Response and Repair Kinase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11139 all species →	ATAXIA TELANGIECTASIA MUTATED ATM -RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004674 all species →	Molecular Function	protein serine/threonine kinase activity	Interproscan
GO:0000077 all species →	Biological Process	DNA damage checkpoint signaling	Interproscan
GO:0000723 all species →	Biological Process	telomere maintenance	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006468 all species →	Biological Process	protein phosphorylation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_037046-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_037046-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

104TPM > 0

7Conditions

7.2Max TPM

1.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	17	1.36	3.21
polyp at pH7 6	18	16	1.24	2.72
coral polyp · control treatment	16	16	1.51	7.18
coral polyp · oil and dispersant treatment	16	16	1.30	5.70
coral polyp · oil treatment	16	16	1.17	2.84
coral polyp · dispersant treatment	16	15	1.38	3.19
Polyp	10	8	0.29	0.61

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.21
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.19
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.25
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.94
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.75
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.53
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.44
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.38
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.18
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.13
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.08
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.04
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.92
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.82
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.78
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.47
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.42
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.72
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.36
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.98
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.90
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.67
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.56
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.46
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.40
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.39
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.05
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.01
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.00
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.85
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.81
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.73
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.47
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.18
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.15
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.88
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.64
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.58
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.37
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.30
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.29
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.26
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.08
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.99
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.66
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.61
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.53
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.39
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.24
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.70
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.03
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.02
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.41
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.32
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.24
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.06
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.04
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.96
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.73
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.70
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.67
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.29
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.26
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.26
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.15
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.84
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.20
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.11
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.67
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.54
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.54
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.46
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.93
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.89
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.86
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.69
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.44
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.43
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.41
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.31
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.31
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.19
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.89
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.18
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.12
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.85
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.59
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.55
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.49
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.22
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.02
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.86
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.82
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.79
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.25
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.20
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.61
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.45
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.42
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	0.40
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.38
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	0.35
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.27
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.05
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.