Gene detail

Detailed information of OS493_037120-T1 in Lophelia pertusa

Genomic Location: scaffold_402:95443...104441
NR annotation: KAJ7318893.1, EH domain binding protein 1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_037120-T1

ATGAGTTCAAAAATACTAAGAAATTTTCGCCGCAATAAGGCAGAGGCCAGCGATTTCCAGATAACAGCATCTGTATCGTCGCTGACCATAGAATGCGTTAAAGACAAATGGCAACCAAACAAGCTTGTTATTGTCTGGCATAAAGAAAAGTCCAAGGCCAGCACAAAGTCGGTTCCTTGGCAGAGTGGACATATTAATCCTTACCGCGGGGTGCACGTGTGGCCAGAGCCAGATCCGGTTAAGACGGACATAACTCTCGTAAAGAACTGCAACATGTGGCCAGAGCCTGATCCAGTTCAGACCAAGTTCACTCACAGAGTTATCTTTGTCTCAACTGGATCAGGCTCGAACACCCAAGGAGAGCTGTTACAATATCAAGACAAAAAATGGAATATTTTTGTCCAAAATCTGTCTCCCAGTGGACGACACAAGGTCCTTGCAACTGGCTCTATAGATATTAATGATTATATCAGTGAAGACCCTAAAACGTTTGACATCACAGTTACTCTCAAACCAGCCAACAGAAATGTTGTGTCTGGTTCAATTGAGTTCCAATTGTCGTCAGTTCTGTTGGAGGATGGCCTTCCTCGTCGCACTGACAAAGAGATCTTTGACGAGATCATGGAAGATGCCAAGGAATTGGCCAAGAAGAAATCTACCAGCAATTCCAAGTCTTCGGTTAACACCAAATCTCTATCAAGGGCGACCAACGGAAGTTCAGTCTCAGGACTGTCTCCATCTGGAGACAAGACTCCAGTGTCAAGCACTGCAACTGAAGAGAAGAAACATGGTGGATCACAAGTTGGTGATGTCACTACTCAGGAGGCTGCCTCCTTTGACAACAACAACAACAACAAGGCAGGGCCAAGGAAAGTCAAGAAGAGGAAGGCACCACCTCCACCTCGCCCTGCTCCGTCTCGCCCTGCTCCGTCTCGCCCTGCTCCCCCTCAGCCACGCCCAGATCAACCACGCCCACCTCGTCCCCCTCCACCAACACAACAGAAGACACTGCAGAAGAAGTGTCATGTTAAAGATGCAAAGAGCTCAGAAAAACACTCTGAGGAAAAAGCTGGGAATTCTGCGTCAGGCCGACGTCGCAATCGCCTCAGTGGGCTAAATAAAAAGGCCAAGGATATGTGTAAATACCCTAAGGAGCTCAATCCATTTGGGCCCTCCACCAACAGCGATGAAGAAGGTTCTGTGGGCGAGGAGATATCTAAGGGTGTGTTTGAGCAAGAGGCTGATATCCAGGAGGAACACAGTGTTGATGATAAGTCTTCACAGGACAGCGAACCTTCGTCATCTAGTCGCCGCAAACGACAAAAGAAAGGTCGAAAGAAGAAATGTCCAACTTATTCCCAGGAGTGTAATCCTTTTGGAGGAGAAACGTTTGACGAGCAACGTTCTTTGTCATTGGGATCTGCGTCTCAACCTTCAGGCAAGGAAACCTCTGTGCAAGGTTTTAAAGTGACTGACAGTAGATGCACAAGCAAGGATCTTGATCAGGGTGATGGCAGAGAAGAGTCGATCAACAACAGTGACACCATCATTCCAATGAATGATTGTGGTGATGATAAGCGAGGCGCTGTCCCAGTGAAGACACCACTTGTGCAGGATGAGCCAGTCCTAAAGAAAGCAAAGCCCTATGCTGCAGGGAAACATGACGGTCAAGAAGACCAAGTTGAGAGTGATCTGTCGACAAAAGAGAAGGAAGGAAAGGCAGATGATGGTCATTGCAGCACTCGTGAGCTGGAACCTTCTCCTAGTGCCGAGTGTGTCTCCAGTGACAAGGTCCGCTGCACCCCACCAGGGGAGGAATCCTCTTCTGATAAAGAAACACCCCTAGAGCAAGGGGCTAATGCCGCAGATCCCGAGGCTTCAACCTCTAGTAAGAAGGTTGCTTCCGTTCATCACCTACCTGAAACAGATGTTGTAGCGAGAGAGATTCAGACGTCAAACCCTGTCCACGAGAAAGATATTGAAAAAGAACACATTAAAGAAAAACAGAGTGAGAACGAGGTGGCTTTGTCTGCGTATGTTGAGGAAGAAATGAAGCTTGTGCAAGACGAAATAACGTCTTTAGAGAGAGTCAGCTTTAAGCTGGAATTGGAAATGCAAGAAGCAATGAAAACCAAAGATTGTGAGGAAGAACTCGAGGGTCTTACCCACGACTGGCTTGCCCTCACCAAGTTCAGCTCTGATCTTCTAAAACGAAAGCAAGACCTTGAAATCCTAGGCAGACAGGAAAATATTGCTGAATGTTGCAATATAATGCGATCTGAACTCAAATATCTCTTTGAAGTTGAAGGCTGGCGAAAAACGGACGAGCACAGAGCTCGCGAGAAGAGAGTCCTGGACCTGCTCGTTTCTGTAAACAAAAGAAATTTAATTGCACAACTGGATTAA

Transcript

OS493_037120-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8NDI1	EH domain-binding protein 1 OS=Homo sapiens OX=9606 GN=EHBP1 PE=1 SV=3
Q69ZW3	EH domain-binding protein 1 OS=Mus musculus OX=10090 GN=Ehbp1 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003007 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12130 all species →	bMERB_dom	Bivalent Mical/EHBP Rab binding domain	Domain	Interproscan
PF10358 all species →	NT-C2	N-terminal C2 in EEIG1 and EHBP1 proteins	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR019448 all species →	Domain	NT-type C2 domain	Interproscan
IPR022735 all species →	Domain	bMERB domain	Interproscan

PANTHER

No PANTHER signature was detected for OS493_037120-T1. This gene does have a gene model — the search simply returned no hit.

Gene Ontology

No Gene Ontology signature was detected for OS493_037120-T1. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_037120-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_037120-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

26TPM > 0

7Conditions

4.2Max TPM

0.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	6	0.54	2.35
polyp at pH7 6	18	6	0.74	2.56
coral polyp · control treatment	16	1	0.26	4.22
coral polyp · oil and dispersant treatment	16	5	0.29	4.04
coral polyp · oil treatment	16	2	0.01	0.18
coral polyp · dispersant treatment	16	4	0.03	0.20
Polyp	10	2	0.19	1.10

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.35
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.25
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.22
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.05
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.99
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.78
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.56
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.48
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.46
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.29
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.98
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.53
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.22
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.04
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.26
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.14
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.13
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.09
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.18
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.03
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.20
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.14
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.10
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.04
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	1.10
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.77
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.