Gene detail

Detailed information of OS493_037180-T1 in Lophelia pertusa

Genomic Location: scaffold_406:3113...16152
NR annotation: KAJ7369680.1, MAGUK p55 sub member 7 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_037180-T1

ATGATTCGATTCTACTCAATGTCGAACGTTACTAATACTAAACAAGGTGATCCATCTTTCCAAAGGCTGTTAACTTGCCTGGAACAAATACGTCACAAGCTTGATAGTCGCGAAGATGATTTCCAATTCTTGGGCAACTATTTCCACAGTAAAGATTTCTGGAAACTTGTCAAGGTCCACAGTACTATTTCATATAGTGATAATGGCAAATCTGAAGCTGTGCATGGTAATGCGGTTGATATTGCAGGACAGGTTGCAGAGACTCTTCTACCTCAGACTGGTTTGAATAAAGAAATACAAGAGCTTCAACACATTTTAAGAAAACCACACTTCAAGGGTTTGTTGCAGGCTCATGACTTAATAGCAGCAGGTGATTTCACTTCAATTGTCCCTGAAGATGAAGAGACATCAGATCAGTTGTTGGAGGAGAAGCCAGAGAAATGTAACAGTGGAGATAACATTCCTGTGGAAAACTACAAAGCAGAGGAAAATGACGACGTCAATATCAATGACCGCATGGGTGCAGATGTCAAGACTACTCCGCCTGCTGCTGATAGCTACAGTACTGATGATGATGGTCGTGGTATAGATTATGAAGAAACAGAAGACTTAGATGAGGCTGATGGTAACAAAGAGAAGGACAATTTGGATAAGAACACATTTGTGACCTTTGCAGACATGGGAAATGACAATGCAGAAGTGTTATCCAGCTGGGATCTACCTGTGACACCGAATAACATGGAATCTGCTTTCCAGCTGCCCGTCACCGACCATTCCATTAGTAAGAGGCAGGGCGGGGAAGACGCCAATGATATGTCAAATGCAAATAATGATATCAAAGAAGAACATGGTATGGGAGGACACAAGGTGGATGGGACGGCGGCGGTGAAAGTCGTTGACAATGCTGTGAGAACTGTCAGGATGTTCAGGAATGCTAAAGAAACACTTGGAATCACTGTAAAAGCTGTGAGAAGTGAAGGAAATGCAGAGAGAATTGTTGTTGCAAGAATATTACGTGGAGGTCTAGCAGATACTTTTGCCGCTCTCTATCTGGATGATGAAATATTGGAAATAAATGGCAAAAGAGTTGAGGGTTTAACTGCTAATGAGGTTGCAGACATGATGGATGGAGTAACTGGAAGCGTGGATATCAAGGTTTTTCCAGCTAAAAAAGACAGGAAACTTACAAGAGAAACCAAGATTTGTTTAAGAGCATGCTTTGACTACAACCCACTCCAAGATCCACTCATACCCTGTAAGGAGGTGGGCGTGGCTTTTAGCACTGGTGACGTGCTTCATGTGGTGAATATGGATGACGCTAACTGGTGGCAGGCCAGAAAGGACGGCTGCAATCATGACAAGGCAGGTCTTATCCCAAGCAAGGATTTCCAGGAAAAACGCCAGCATTTCAACAGGATTTCTTCCTCAAATGATGTCACCTTACAAAACGACAAGAATGGTAGACAAGCGTCACCTTTCAAGAGGATGATAAGGAAAACCACTGATTCAAACAAAGTTTTTTGTAATTTCTTGCAAGATATACAAATGGATGGTTGGCCTGCATATGAACCTGTAGCTAAATATCTGGAAAGACCTGAGAAAAAGAGACTTCTTTTATTAATAGGAGCACCTGGTGTTGGAAGAAATGAGATAAAGAAGTTGTTACTCTCAAACAGTCCTGATAAATTCATAACAACAGTTCCTCATACCTCCAGACGCATGAAGAGCTATGAAGCAGATAGTAAGGATTACTTCTTTGTATCACGGCAAACTATGGAGAATTTTATCCAGAAGAGAAAATTAATAGAGTTTGGTGAATACAAAGGTTGTCTGTATGGCACATCAATTGACTCTATCAAGAGAGCTTTGAAATCTGGGAAAACGTGTGTCCTAAAGATACAACCAGAGGTGATGTTGATGTTAAGAACAACAGAGTTCAAGCCATACTGTGTCTACATTAAACCCCCTCCACTGAAGGAACTCCGCACATCAAGATTGACAGTACAGGCTAAAAGCAAACCAGCTTCAGATAAATCATTAATGAGAACATTCAAGGAGGAGGATTTACAGGAGATGATCAGTGCATCAAGAATGCTGGAAGATACCTATGGACGGTTCTTTGATTTGACAGTGGTGAATAAGGAGATTGACGAAGCTCATGTCAGTGTAACAGAAGCATTTGAGAGACTTGAACAGGAGGAACACTGGGTTCCTCTGGACTGGGCACAGAAGAACTAA

Transcript

OS493_037180-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6P0D7	MAGUK p55 subfamily member 7 OS=Danio rerio OX=7955 GN=mpp7 PE=1 SV=1
Q5U2Y3	MAGUK p55 subfamily member 7 OS=Rattus norvegicus OX=10116 GN=Mpp7 PE=2 SV=2
Q5T2T1	MAGUK p55 subfamily member 7 OS=Homo sapiens OX=9606 GN=MPP7 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000787 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00018 all species →	SH3_1	SH3 domain	Domain	Interproscan
PF02828 all species →	L27	L27 domain	Domain	Interproscan
PF00595 all species →	PDZ	PDZ domain	Domain	Interproscan
PF00625 all species →	Guanylate_kin	Guanylate kinase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001452 all species →	Domain	SH3 domain	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR036034 all species →	Homologous_superfamily	PDZ superfamily	Interproscan
IPR036892 all species →	Homologous_superfamily	L27 domain superfamily	Interproscan
IPR004172 all species →	Domain	L27 domain	Interproscan
IPR050716 all species →	Family	Membrane-associated guanylate kinase	Interproscan
IPR008144 all species →	Domain	Guanylate kinase-like domain	Interproscan
IPR008145 all species →	Domain	Guanylate kinase/L-type calcium channel beta subunit	Interproscan
IPR014775 all species →	Domain	L27 domain, C-terminal	Interproscan
IPR036028 all species →	Homologous_superfamily	SH3-like domain superfamily	Interproscan
IPR001478 all species →	Domain	PDZ domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23122 all species →	MEMBRANE-ASSOCIATED GUANYLATE KINASE MAGUK	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0005911 all species →	Cellular Component	cell-cell junction	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_037180-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_037180-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

61.6Max TPM

24.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	29.69	48.96
polyp at pH7 6	18	18	27.90	45.53
coral polyp · control treatment	16	16	22.18	36.65
coral polyp · oil and dispersant treatment	16	16	18.01	29.24
coral polyp · oil treatment	16	16	29.12	47.85
coral polyp · dispersant treatment	16	16	13.22	29.17
Polyp	10	10	29.29	61.60

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	48.96
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.79
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.09
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.78
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.66
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.57
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.39
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.14
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.92
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.79
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.12
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.33
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.74
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.80
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.67
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.93
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.76
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.02
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	45.53
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	42.60
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.88
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.31
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.80
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.45
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.45
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.49
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.74
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.32
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.15
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.07
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.90
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.69
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.57
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.97
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.81
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.47
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.65
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.00
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.03
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.19
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.97
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.98
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.41
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.20
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.13
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.41
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.76
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.63
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.44
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.35
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.27
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.49
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.24
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.16
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.33
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.45
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.06
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.97
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.12
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.09
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.39
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.29
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.50
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.78
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.63
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.45
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.12
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.58
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	47.85
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.13
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.33
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.58
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.29
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.32
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.76
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.32
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.20
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.01
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.18
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.18
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.26
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.01
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.72
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.80
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.17
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.52
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.16
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.38
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.61
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.71
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.90
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.83
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.17
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.67
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.67
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.42
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.45
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.11
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.98
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.71
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	61.60
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	56.93
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	38.13
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	35.91
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	27.70
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	24.01
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	15.13
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	14.23
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	10.44
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	8.83

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.