Gene detail

Detailed information of OS493_037187-T1 in Lophelia pertusa

Genomic Location: scaffold_406:170194...181301
NR annotation: KAJ7369685.1, YLP motif-containing protein 1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_037187-T1

ATGATAGGCACTGGCCGCCTAGAGATGATAGGCACCGGCCACCATTCCCTAGAGATGATAGACACCGGCCACCATTCCCTAGAGATGAAAGGGACGTGCCACCATTCCATCGAGACCGGCCACCATTCCCTAGAGATCATAGAGACCGGCCACCATTCCCTGAAGAAGAAAGAGATTTTCCATTCCCACCAAGAGGCGATAGGGATCGTTGGCCACCACCACCAAGGGAAAGATGGCCGCCATTTCCTCGAGAAGAAATGGATGAGTTTAGGTGGTCAAGAGAACGTGGCCCACCAGGTAGACCTTTGTCTCCTAGGGGGAGAGGTGCAAGGGGAAGACCCCCATTCCATGAGGATGAGAGAGGAAGATGTATGTCACCACCTCCCTGGCCCCCAGGAGAGCATTTCAGACCGGGACGATCTCCCCCTGGAGATTTCAGAGGCAGGCCTCCACCTGAGGGATTTGATCGGTTTGGCCATCCTTTGTCACCTCCCCATGATGAGCGAGGCAGGCCACCTCCTCCCCATGATGAGCGAGGCAGGCCACCTCCTCCCCATGATGCCCCATGATGAGCGAGGCAGACCACCACCACGAGACTGGGATAGGAGAGACTGGAGACCAGGTCCTGGAGAAGAGAGATTTAGAGAACCTCCCCATCCAGATGATCAAAGGAGAAGATCGCCGCCGCCACCCCACAGGGACCATCCAGGTCGTTTTCCCCCAGACCACCCTAGAGAATGGGAAAGAGATGATAGGAGAGGTCCGGATGACAGATTTTATGATGAGCGACCTCCTCCAGACAGAAGACCCCCATTTGATGATTACTTGAGGGAGCGACCTCCCTACCCTGAGGAGCATCCCCCACATGACCCCGCTGCTTACCCACCCCACCCTGAAGAGGGACGACACCCAAGTGAGGCACCAAAAGTGGACAAAAAACCAGAGACTGTTCCTGTTGACAGTATTCTGGACTCTCCAGGACGTGATTCTAGACCTGATAGAATTGTCATCATCCTCAGAGGCCCCCCAGGGAGTGGCAAAACACATGTGGCCAGGCTAATTAAGGACAAGGAGGTGAACTATGGAGCACACGCTCCTCGAATCTTAGCTTTGGATGATTACTTTTTAATGGAAGTGGAGAAATCTGAACAAGACCCTGACACTGGAAAAAAAAATAAAGAAGAAGGTACATGTAACAATGAAATTCCTGTGCCATGTGACATCAAGCTTGTTCTATTCACAGGAGATGACAGTAATGCCACAATTCTACAATGTCAAACATCTGTAACAGAGTATGTATATGAAGAGGAGATGGAGGAGGCCTACAGAAGCAGTTTGTTTAAATCCTTCACTAAGACACTGGAGGATGGTTTCTTCCCTGTCGTTATAGTGGATGCTATTCATGACAAGGTTGAACATTTTGAGAAATATTGGAGTCATGCAAAACAGAAGGGTTTTGAGGTTTATGTCGCAGAGTTAATGGCTGATGCTCATGCTTGTGCCAAGCGGAACAGTCACAATCGCACCTTTGAGGACATCAACAAGATGGTTGAAGCGTGGGAAGAAACACCAACCCATCATCTCAGACTTGATGTACGATCACTGTTGCAAGATGCTGTTATTACCGAGGTTGAGATGGAGACAGCAGATGAATCTATTGCGGCAGATGCAGGACAAATGGAAACACAGGAACAGCTGGACGACGAAGAAGAGTCTGAGGTACAGGTCCCAACACGCAGCAAATGGGAAGACATGGAGCCAGCGGAAGACAAACTGAATAAACTTGACGGTATCCGACCAATGAAGAGGAAAAGAGAAGAGTCGCCCCCATTCCCTCTCAGTGATGATGACGATGACCCGTACGACGAACGCGAAGAAGACATGCGCATTGGCAAGAAGAGGGTTCGGTGGGCGGACCTCGAGGAGAAGAAACAAATGGAGCACAGAAGAAGAATTGGCTTTTGCATAGGTACCGACTGGAGCTTGTTAACGGATCCTCACGCCGAAATCCCCCGTACCTCTGAAGCAGCGTCCAGCAGCGAGCGCCCGTCTGAAGAACAAGACGACAAATCAGACAAGTTTCGTTGGGACTTTTTATTTAACCGTTTGTCTCCTCAGATTATGAATGTCATACAGTAG

Transcript

OS493_037187-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P0CB49	YLP motif-containing protein 1 OS=Rattus norvegicus OX=10116 GN=Ylpm1 PE=1 SV=1
Q9R0I7	YLP motif-containing protein 1 OS=Mus musculus OX=10090 GN=Ylpm1 PE=2 SV=2
P49750	YLP motif-containing protein 1 OS=Homo sapiens OX=9606 GN=YLPM1 PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004419 (this species only)

Pfam domain

No Pfam domain signature was detected for OS493_037187-T1. This gene does have a gene model — the search simply returned no hit.

InterPro

InterPro term	Type	Description	Source
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR026314 all species →	Family	YLP motif-containing protein 1	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13413 all species →	YLP MOTIF CONTAINING PROTEIN NUCLEAR PROTEIN ZAP	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0032204 all species →	Biological Process	regulation of telomere maintenance	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_037187-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_037187-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

70.9Max TPM

34.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	32.05	45.97
polyp at pH7 6	18	18	35.29	65.69
coral polyp · control treatment	16	16	40.33	70.88
coral polyp · oil and dispersant treatment	16	16	33.06	52.42
coral polyp · oil treatment	16	16	40.81	56.18
coral polyp · dispersant treatment	16	16	27.42	52.94
Polyp	10	10	33.34	52.22

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.97
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.73
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	41.55
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.71
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	36.41
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.47
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.51
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.28
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.22
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.20
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.92
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.90
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.86
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.30
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.12
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.08
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.25
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.37
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	65.69
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	61.85
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.47
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	40.94
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	39.69
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	39.56
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.56
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.30
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.72
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.31
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.23
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.27
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.55
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.93
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.98
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.43
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.61
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.18
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	70.88
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	50.20
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.19
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	45.33
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.78
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.42
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.56
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.47
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.98
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.64
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.46
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.21
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.93
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.49
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.53
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.22
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	52.42
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	44.51
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.00
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.20
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.84
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.81
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.11
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.80
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.92
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.20
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.38
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.62
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.56
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.50
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.70
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.45
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	56.18
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	54.83
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.28
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.17
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	44.08
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.86
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.55
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.24
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	40.63
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	38.66
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.49
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.33
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.19
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.72
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.66
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.11
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	52.94
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	41.09
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.67
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.21
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.95
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.54
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.81
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.40
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.17
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.14
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.88
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.68
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.96
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.94
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.99
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.37
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	52.22
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	42.45
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	39.60
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	38.77
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	34.24
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	31.35
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	30.99
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	24.19
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	24.02
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	15.60

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.