Gene detail

Detailed information of OS493_037194-T1 in Lophelia pertusa

Genomic Location: scaffold_407:6273...12961
NR annotation: KAJ7351014.1, hypothetical protein OS493_037194 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_037194-T1

ATGGACGTCAGCAGAGATGAATCAAAGAGAATTCTCAGGAGGTTGGAGCTGGAGGCATATTCATCCATCATCAGTGCTTTTAGGGCCCAAGGAGAGTTAAGTCGGACAAAAAAGAAGATCTTACAGGATCTAGGAACTCAGCTAAGTATATCAACAGAGCGTCACAGGGCAGAAGTTCGAAGAGCATACAGTGATGATAGACTTGGCATTGTAGCTGAAAGCATTTACGGTGCAGGTAGCTGCGCTGAATGGGCAGCAGAGGGTAGACGACTTGTTCCATTGATGCCACGCCTTGTTCCACAAACAGTGTTCAGTGCTTCAGCTACTGCTGCGGCTAATTCTGCAGCTGCGACAAATGCTAAGCTTCCAGTTTCTTCAGCAAACTCCTCATCTTCAATCAGTCCTTCTAAAGCTGCTGCTGTGAAACAGCAGCCACAGACAGGTGGAACCCAAGGGAATGACGTGGATGGTTATGACGATGATGGCAAACCAAAGCGAAAAAGACGTCTGAGTGTATCAAGCCTTAACAAGCCAGTGACAAAAGTTACTATCCCCACCCCCATACTGGTGTCAAAAGCTCTCAGTAAGCAGACCACGTCAGTGAGTACCATGACCAAGTCTGGCAAAGTTCTAGGACCAGCAGGGACAATTAAGGCTATTCCACGTGCCATGCCTCTTCCTGCCTCGGCATCACAAGTGAAACTACTCACCAAGACAGTAGCAGTGTCGCAGGCTGTCTGTCAGGCCAAGACAGTCCTAAGCTACAAAACCATGACATCTGTTACGTCATCGTCAGCCAAAGTCCAATCGGTGATGACTCAGTCAACTCCCAAGACACAAACCAAAGTTGTCTCTGGGACCCCTCCTAAGGCCATGGTAACATCAAAGGCTCCATTGCCGACTGCTGTCAGGAATGTCCTGTCAGCGGCGAGTGTAAATCCTATTGGAGTGGCTCTCAAAACCGGTTTAACAGCAGCTCAACTTGTGGCACGACATAAAGTGAAACCAGCAGCGGCCAGATTTAAACCTCTTCCAGGGACTGTGAAGTTCAAGTCAGTCACACCGGCCACCATGGGTACCTGTTCTACTGTTACCATGGTAACACCCAGTCCTAGTACTCAAGCCTCCTCAACCTTACCAGTCTCAAGCACTCAGCCTGTTGTGCGTGTAATCCACGTTCCGGGGACAGGAGGTGTTGGTGTAAGCAAGCCAGTCGTTGTCATGACAACGGGGCTCAGCAAAACCACTGTTGCTAGCATGATGCCGGGAATCAGTAGTCCAGCCAGTTTAACAAAGTCCACTTCTCAGGTCACTCAGAATACAGCAGTCAGCAAGGCTCCAGTTACTACAACTACGACACTGACATCTCAAACTCTGTCAAAAATCAAAGTTTCTAACCCAGTAACTCAGCCAGCATCATCAGCTCCCAAAACTGTTGTCATGACAACACTAGTGGGTGGAACAAAGAGAGTGGTTCTCTCTGTCCCAGCTCCCTTGCAGCCTGCTCCGACTATTTCTATCCCCACAACCTCCTCCCAGGGGCTAGTTATCGCCAAGACACAAGGAATTGCGCTGACTTCCCCAACAGTCTGTCAGTCTCAACCCACTTCCAAGAAGGACACTAAGCCATCTCCAGCCTTGGCTACTGTATGTCCAAAACCTTCTGCTACTCAGATAACACCCAGTCTGCCGGCGCCGACTGTCACTACGCAAGTCAGATCAAGACCACTACCTGCTATTCTTCCTGCCCCGCCCAAACCATCAAGCGTAGCACCAACGGCTGTCTCCAATACGGCCAGTATCAGAAAGCTTCCTACCATCTTACCTGCTCCAGCAAAAAGTGTTACAGCTGTCATTCCGACTGTTCTGGTACCCATGGCAACTGGTGTAGTTTCACACACTGCCCCACAGTTGCAGTCCTCAGTGCCGCTGGCTGTGAATACAGCCGTCTCCAGTTTAGCATCATCATCTTTGACTGCTGATGTCGTAGGGCAACAGCTTGCGGCTGTAGTTTTAACAAGTCCAGATGTTGCTCTGGTTTCTGCCAATCAGGATAAATTGGTCTCTGAGTCCCATGGTTCAGATGTAAGTGACAATCATTCGTTAACAGAAAACCAGTCATCAAGCTCTAAAATGCCAGTACTGAACGAACAGAGCAGTGCTGCGGAATGCGATAATAACACATCATCTGAAGATGACTCTCTTCTCATGTGTTCTGAAACAATCGACAGTGCAGGCTGCGGCATCACTGAGCCGACCCCATCAGCTATGGATTTCTTCAAAAGTATGGCTGAGAGTACACCTATTAAAGATCCAGCAGAGCATGTCACAGATGAAATGCCGCAAACAGTGTTAGGTACTGGGGAAGTAGTTTTAGATCCAGTGTCGTTACAAGATATTGAAGTATCCGTCTCTGATTTAGATGCTTTGAAAGACTCGACTAGTGAAACAGAAGCATCTGAAAAACATGTAGCTAAGCAATCCATCGAAAATGTAACTGTTCAGAGATTGGATGTTACCAGTGGAATATCAGATTTAGTAGGGGATCACTTATCTGACCATATTTACTCTGAATCATTGCCCATGGATGAAGAAGATAAACATTATAAAGCTGACGTGGAATCTGATCTTCCATCGTCATTGCCAGGAGTTCATGAAGATGATCAAAATGTGGTCATAGCAGGCGGTGAGGATGGGTTACCTGTGGAGAATGCCCTGCAAATTATTGAAAGCTTTGTGGAAAGTATGGAAGGACCTTCAGTGGGAAACATCTGA

Transcript

OS493_037194-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q7Z589	BRCA2-interacting transcriptional repressor EMSY OS=Homo sapiens OX=9606 GN=EMSY PE=1 SV=2
Q7ZUV7	BRCA2-interacting transcriptional repressor EMSY OS=Danio rerio OX=7955 GN=emsy PE=2 SV=1
Q8BMB0	BRCA2-interacting transcriptional repressor EMSY OS=Mus musculus OX=10090 GN=Emsy PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005788 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03735 all species →	ENT	ENT domain	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR005491 all species →	Domain	ENT domain	Interproscan
IPR036142 all species →	Homologous_superfamily	ENT domain-like superfamily	Interproscan
IPR033482 all species →	Family	BRCA2-interacting transcriptional repressor EMSY	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR16500 all species →	BRCA2-INTERACTING TRANSCRIPTIONAL REPRESSOR EMSY	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005654 all species →	Cellular Component	nucleoplasm	Interproscan
GO:0006355 all species →	Biological Process	regulation of DNA-templated transcription	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K25790	EMSY; BRCA2-interacting transcriptional repressor EMSY	-	DNA repair and recombination proteins	ko03400	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_037194-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

15.2Max TPM

3.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	3.36	5.56
polyp at pH7 6	18	18	3.42	5.85
coral polyp · control treatment	16	16	4.95	15.23
coral polyp · oil and dispersant treatment	16	16	3.72	9.46
coral polyp · oil treatment	16	16	3.78	7.57
coral polyp · dispersant treatment	16	16	2.77	7.99
Polyp	10	9	1.55	3.63

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.56
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.37
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.74
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.25
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.93
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.92
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.65
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.35
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.32
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.25
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.06
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.69
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.62
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.61
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.42
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.36
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.99
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.41
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.85
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.02
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.78
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.71
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.06
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.94
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.71
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.68
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.35
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.28
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.97
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.94
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.88
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.33
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.24
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.08
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.97
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.78
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.23
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.19
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.09
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.84
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.65
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.51
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.98
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.96
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.40
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.20
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.04
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.83
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.77
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.62
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.52
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.31
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.46
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.95
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.97
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.84
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.63
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.23
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.17
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.51
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.49
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.43
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.16
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.55
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.56
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.47
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.26
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.87
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.57
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.34
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.96
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.49
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.97
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.48
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.41
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.92
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.33
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.31
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.75
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.49
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.04
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.83
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.32
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.25
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.99
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.29
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.16
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.65
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.57
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.31
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.00
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.88
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.79
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.25
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.05
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.66
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.12
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.84
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.44
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.24
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	3.63
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	2.85
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.41
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.90
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.65
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.08
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.77
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.72
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.51
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.