Gene detail

Detailed information of OS493_037470-T1 in Lophelia pertusa

Genomic Location: scaffold_428:122882...140088
NR annotation: KAJ7382056.1, Unconventional myosin-X [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_037470-T1

ATGTGGCTCGACGAATCTTCTTTGTATACATTCAAACGATTGTTTTATTTTCTAGGGATCTCGTGTGTGGCTTCTCGAGGGAAAGATTGGGTCCCTGCTACAGTAACAGAGTCTAAAGGCGGTCAAGTTACTTTTCACACCGAGTATGATAAGACCTACAACATGGCCAAAGAGTCGCTCAACAGACAGAATGTCACAGCGATGCATCAAACAAGTGTGGACGGGGTGGACGATATGGCCAACTTAGGCGACCTCCATGATGCCGCCATTCTCCACAATCTTCATGTTAGATACAAGAGCGACAAGATATATACCTACATTGGATCAATCTTGTGTGCAGTTAATCCTTATTACGTGGTTGAAGGACTTTATGAAAGTTCGGTAATGGCAACATACAGACAGAAGCATATTGGCGAGCTTCCACCTCATGTGTTTGCGATTGCTAATGAGTGCTACTACGCCATGTGGAAAAAGGGAGAAAGCCAATGTGTACTGATAAGTGGTGAATCAGGTGCTGGCAAGACAGAGTCCACAAAGTTTATTTTAAAGTATTTATCAGATGTTAGCAGAGGAACAGGAGAATTGGAAAACACACCAAATGTAGATGATTCCATACTGCAGAGCAGCCCTATCATGGAAGCCTTTGGTAATGCAAAGACTGTTTACAACAACAATTCAAGTAGGTTTGGCAAGTTCATTCACCTGCAGTTCAACTCCAAGGGACGAATGGATGGAGGCAAAATTCAGGACTGTGTCTTGCTCTTGAATTCGCCAGACAAGTATCACTACCTCAAGCAGAGCGGTTGCTATGGAGACCCTTCAATCAATGACAAGGAGGATTTTAACAACGTTATGAATGCCATGAAGGTGATGTGTTTCACAGATGAAGATATTGCCGATGTCTTCCAGGTCATTGCTGGGGTCCTGCAGCTCGGCAATGTTAATTTCATGGCTGCAGGTGGCGCTCAAGTGGCAGAAAAAAGTGTGTTGGAGAATGTAGCAAATCTTCTTCATGTGGACATCTATGAGCTGACTGACGCTTTAACCCAGAAGTCAATGGTCCTTAGAGGAGAGGAAATCCAGTCACCGCTGTCTGTAGAACAGGCACTGGACTCCAGGAATTCAATGGCGATGAATCTTTATGCTTGTACGTTTAAATGGCTCATCAACAAAATCAACCAGAGGATCAAGGGCAATGAGAGCTTCTGCTCCATCGGCGTTCTTGATATTTTTGGATTTGAGAACTTTGACGTTAACAGGTTTGAGCAGTTTAATATCAACTACGCCAACGAGAAGCTCCAGCAGTATTTCAACAAACATATCTTTTCACTGGAGCAACACGAGTACAACAGAGAGGGCTTGGAGTGGACAGACATTGACTGGGTGGACAATGGGGAGTGCCTGGATCTCATTGAAAAAGGTAATACCTTTTATGTTAAGCCACGTGTGGCAAACACCAAGTTTGGAATCAAGCATTATGCTGGCGAGGTCTATTACAGTACCAAGGGTTTTCTGGAGAAAAACAGAGATAATTTTCGTGATGAAATTCTCAGTGTGCTAATGGATAGCAGGTCGGATTTTATTTACGACATAGTTGAACATCTGAAGCCCTCTGTGCCGGCATCAGGGACAAAGAAATCCTCAAGGAAAAGGCCGACTGTTAGCTCTCAATTTAAGACATCCTTGGCGTCTCTTATGACCACGCTGAGTCAGTCACATCCATACTTTGTGCGCTGTGTTAAACCCAATGAAAAGAAGGTACAAACCTGCAATTTATTTCTTGGCGAACAGGTTTTCATGAAAGACAACTTGGAGTACATGATTGAACATAAAAGAAACACCCAGCTGGAAGCCGTGGCCATGTTGATCAAGAGAAGGATCTTGGGATACCTTCAGCGGAAGAAGTATTTGAAGATTCGCCAGGACATCATTACAATACAAAAGAACTACAAGGTACTCAAATTCTCTAACTTATTTTCTGTAGGGCCTATGGGATTCTTTGTGATTTGCTTTTCTAAATCGCTTCGAAGTTCCTACTTTAAAGGAACTATGTCACGATATTTTAAGTCATTTTAG

Transcript

OS493_037470-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9HD67	Unconventional myosin-X OS=Homo sapiens OX=9606 GN=MYO10 PE=1 SV=3
F8VQB6	Unconventional myosin-X OS=Mus musculus OX=10090 GN=Myo10 PE=1 SV=1
D3ZJP6	Unconventional myosin-X OS=Rattus norvegicus OX=10116 GN=Myo10 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002897 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF18597 all species →	SH3_19	Myosin X N-terminal SH3 domain	Domain	Interproscan
PF00063 all species →	Myosin_head	Myosin head (motor domain)	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036961 all species →	Homologous_superfamily	Kinesin motor domain superfamily	Interproscan
IPR001609 all species →	Domain	Myosin head, motor domain	Interproscan
IPR040640 all species →	Domain	Myosin X, N-terminal SH3 domain	Interproscan
IPR051724 all species →	Family	Actin-based Motor Myosin	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46049 all species →	AGAP003327-PA	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003774 all species →	Molecular Function	cytoskeletal motor activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0016459 all species →	Cellular Component	myosin complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_037470-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_037470-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

105TPM > 0

7Conditions

36.5Max TPM

7.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	17	4.59	9.25
polyp at pH7 6	18	16	5.58	13.25
coral polyp · control treatment	16	16	9.39	19.69
coral polyp · oil and dispersant treatment	16	16	13.06	25.26
coral polyp · oil treatment	16	16	7.46	15.13
coral polyp · dispersant treatment	16	15	12.23	36.52
Polyp	10	9	1.56	3.30

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.25
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.93
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.50
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.09
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.67
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.45
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.94
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.59
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.52
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.37
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.32
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.27
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.26
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.90
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.97
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.68
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.92
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.25
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.22
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.56
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.65
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.14
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.99
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.58
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.06
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.06
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.87
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.75
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.32
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.06
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.42
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.24
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.23
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.69
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.04
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.48
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.63
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.30
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.10
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.64
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.85
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.78
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.68
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.36
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.13
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.55
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.53
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.34
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.19
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.26
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.08
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.09
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.57
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.80
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.77
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.32
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.89
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.48
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.45
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.24
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.85
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.17
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.86
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.50
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.67
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.13
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.35
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.51
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.68
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.96
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.63
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.33
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.82
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.06
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.85
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.87
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.23
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.47
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.41
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.38
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.75
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.52
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.74
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.79
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.52
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.31
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.34
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.15
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.74
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.46
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.14
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.26
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.57
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.12
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.20
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.87
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.30
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.26
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	2.13
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.94
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	1.75
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.48
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.30
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.08
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.32
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.