Gene detail

Detailed information of OS493_037574-T1 in Lophelia pertusa

Genomic Location: scaffold_436:125791...152132
NR annotation: KAJ7369624.1, Protein unc-80 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_037574-T1

ATGTACATGGGGAGAGTGTTAACAGCTGTAGCCTCGCCAACTGGAAGTGATGATGATTCTCAAGACCTTGGCGACACCGGAACATTTCAAAACACCAAAGTTTATATTAAACCGTCTAACACGCTTCATGTAACTTCAGTGAGCAAAGAGGGTACAAATAAGCAAAACGACAGTGGTCCATTTCTTGATGAAGCCAAAGCAGATGAAATTGGTCCACAGAATAGTAATCTGATTAATTATACTAGCAGTAATGTTTCTACAAATAGTTTTACTTCAGAAACCCCATTGGAGGTTAACCCAGTAGAGGCATCAAACAGTATTTTTCCATGCCCTGGTGAAATAGCTTCATCAACTGTTCCAGAGCAAGCTGTTGCAGGCCCTGGTCAGATAAGCAATCAACAATTAAACAGTTCTTCTGGAGCATTTGAAAGCATGGTTTCATATGAATGTGAAGTCCAATATTCCCAAACAGAGAGTGGAACAACGTCAAGTGATCAACTGAAGGATGCATCACTTTACAAACGTCTTTCAGAGCATGCAAGCTCAAGCCATGCAAGCAGCAGCTCAGTCGAAAGTGAAAGCCAGCCATTGTTAAAACCTTCAACGGCAATGCATGTAAAACCCTTAACAATCCTGGGCGCATTTGATAGTCCACAAAGCATCAATCGAGACTCGTTCATGAGAACAGACAGGTATTTTGTGTTTCCAGGTGCAGCTGACTACATCACGACTGATGGTAGATTGAGCTCTCTGATGATTCTACATGCTCTCAATAGTATCATGCGTGAGAACCCTACATCCCTTATCTGTGATGCCACACTCACTGTCCTGCAACATTTAGTGACAGTTCATGAAAACAAAAAATCCAAGAAAAGGGGAAGTGCTGTGGAAGTTGATGACAGGACTGTTGCCGAGACACAGGCTATTGGCTTCAGGAGCCCTCACAGTGACAACGTTCTTGGTAGACTGCGAGCCAGCTTTTATGGAAGGCCCCCAAGTTTCCTCAATCTAGCGATGGGCTGTTTGGTTAGTCTTGTCAAAGCCCTGGGATGTCCTTTAGGATGTGGAGAAGGCTGTCGTGGGATCACTGGTGATCGGCTCCGAAATCTAGCTAATAACCTCCTTTCCCAGCTCTTGCACAGTGATGAAGCTGCGTTCAAACTGTGGCTTCACCAGTTTGCCCGATTAGAGCCTCATGAAGACTTGGTGGACTTCCTTCATGCCCTAGTTGGCTTCTGTGAGGAAGATCAAGAACAGTCAGATGATGAGATGGTAATGGAGCCAAAGGCTGAGAAGAGGACCAGGAAGAAGAGTCTTTTTACCATGCCAGAAGGTGTCAATAGTGTCATTATTGGGGGAATTTTTAAGATATTGCTCAGCAGAGTGGCAGAGATGAACTTCCTTGACCTGACAAATTTGACATTTTATGGTGAACTGCGGCAACTTCTGAGGTTTGTGAAAGAGTCGTATGGTGGTGTGTACTGGAAAGTTGCCTTAAGTGGACTACTGGACTCGGCTTTCAAAGAAACAAAAGACCAAGGCGACACAAGCAAAACCCCTGGGCAAGAATCGTTAACTAGAGGTTTATGGACAGTCCAGAAGAGAGCCACTGTAAGAACAAAAGTCGAGAGAAGTTACACTTACAAAACCAAGCGCAAGTTTTTACAGAAGTTTGGCCGTGTTACAATGGAGAGTTCTGAAAGTAGCACCAGCCTGACACAAAGTCCAAAAGTACCCGCTAGTGTTGATTCTAACTCTTTGGAGACAGCATTGTCTCCAAGAAGCAAGAGAAAGATCTTCACCCTTGGTACTTGGAGAAAGCAGAAAGCTGTGGGCACACCTTATGACAGCGTTGAAGACCTGTTAGACCCTTCTGATGCTCCGCCTGAGCAGCAGTCATCAAGCGCAAGGCGCAAGCTTCTCAAGTCGAAATCGTCTACTAGGAAGAAACTAGATGACGTCTTCCCAATATCAAGGAAAGGAGATGGAATGCTAAGCTCCTTTAATGAGCCGTCCCTGCCTATTGACATTGTTGTGCATGAATTTGAGACTAAACCAGTCGATGTAGATGCCCTTAGAGCTGGTATGGTCAGGTTTAGGTTTCTTCTTCATGGGGGCCAGCCGGGTTCTGTACCAGATCCTAAGATTTTGGCATCCATGCTGGACTTGGAAGCACCAGCTGTATCCAGGGCATGTCTTCTGCTTGAGTGTTGCATCCTGGTTAACAAATGCAACCAAGGTGAATGGCCCCAGTGGTTGCGTGGCAGCCTTCCTTCACTGGCCCATCGTCGAGGTGGACACTCACCAACCACTGCTTCCCCATTCATGTTTGCTCAGCGCCGCAACCTTGTGGCCATGCATGAGGCTGGCGTCTTGTTTCGTGCTTGGGGTGTGGCATTGGGCAAGAAACTGGAGCAGGTGTTGGCTAAGAAGAGGCGAAAGTTGTTGCCGTCTATTGAAGAGGAGGGAGTAAAACCAACCCTAACAGATGTAGACGATTTAGAGGAAGATTTTCTTGACGAAGCAACATTGAATGACTCTGTGAAGACCTGCCCCTACCCACTTTTGATGATAGCGTGTCAACTTCTTCTGGAGATAACAGCTTTCTTACGCGAGAGCCATGGCTTGTACTCAGTCAACAAACCCGCTTCCAGACCCTTACATCGTTTTGTTGCACCTAGAAGACGACAAAGTGCAAACATCCACAGACGCTCTACTGCATTTTCCCCTGAAGTGCATCAGCGCCGTTTAAGTAGTTTAATTGGCGGTGGAGGAGAACGTATTCGGAGAGCTAGCATGATGAGCCAAACCTCTTTACAAACTGATTTTCCTTCTAGTCCCAGTAAAACCTTACAGGAACCACCAATGATAACTGTCTCTGGAACAGATCATGAAGCAAGGAAAGAACGACGAGATAGCGCTTCAGAACGATCAAGAAATCGCCAAAGCTTGTATTACCCTAGGGTCAGTACTCAACACTCACCTAAAACGGCACAACGGGTTGCCAAACATAGTGCTATTGGTGGAGAAGGTGAATCAGTGAGATACAGATCAAAATCTACCAGATGTGATGCCAAGCATCTCAGCGTAGATGCATTAATGCTAGATGAAGATGATGAGTCGGATGATGAAGATCCGAGTGTGAATTTACCATGGCTGAGTGCTGTGATCCAGCTGAACAGCTCAACGGCATTCCTGTGTGACCACCAAGGGGTGTGTCCGGTCAACTGTCATCAGCGACAAAGCCGTAGCTGCACTCGGATGGTCAAAGCATTGAAGACAGTTTACAGTTCTGTGAGCAAGCAGGATAAGAATGCTGACAAGCAGATGAGCAGAGGACGCAGCAGTCCTCTGATCAGTGCACCACAAGTGGGCTCAGTGGAACAGACATCTAAGAAGAACAAGGAAGATAAGGAAATGACACAGTACATATCATCAAGTATTGCAAGTTTAACTCACTGTCCGTTCTCAGTGATTGCAAAAGCTGGGACAGTGATCAACACCACTCATCTGATGGATACTCTTCCTGTGGTGTGGGAACTGCTTCTTGATGAGGATCAACAGCTGGTGTCATCTGCAGCTGCAGTCTTTCTTCTGACTGGTATTCGTCTGAGAGACACCGTGGAGCAGATGTTACACAAAGAACTTATCTGCAGTGATGCCAATGAAAGAGTCAAATCTCTTCAGAGATTTGAGGTTTTGTGGCAATCCAGGTATCATGCTTGGCCAAGACTTGAAGAAGGAGCCAGAGTGATTTTAAAGGTGCCACCACCAAAAATTGACTTCACCCTCCCATCCCCTACTGTGGGTATGCCCTCAAGCCACCCCCCTGATTGCCCTTGGGATGCGCGTCTTATCCTGGAGGAGCAGCAAGACAAAAAGAATCAGGACAAGAAAAAGATCCGTGACAGTGGAAGTGCATTGAAGAAGCAGCAGGAGAGATCTGAGTTTCTATTGCGAGCTGTTCCTGTATCGATGGAAGCAACAGTCGGTGTTAATGTTGCAGAGGACGAGAAAGAAAAGTGTGCTCGCATAGATGTTTGGCGCTATCATTTGGAAGCTACGGAAAACTCTGAAGATTTGACAGAAGGAGATGGAGGTGAAAGTCAACAAGTGGAAGCTGAGTTATGGCCACAAGCTGTGTCATCAGCCATTCCTGACATCATCAAAATGATGGACGATGTTCTTGTGGATAGCGATAAAATAGCTGTGATGGAAGTCGCCCGCCGGCTCGTGTGGAGATGTTTAGTTGATGATCCAGTTCTTTTCTTTAGAACTATTTTAGAGCAGTTAACAAAGAAAGACAAACAGGAAGAACACATCGCACTGCTCAGGAAGTTGCTTCTTTACATCACAGACCTGCCGCAGACTTCCTCGAGATTCCTCATCAACAATCTGATCGGCGTGGCAATGTTTTATGCCAGAACTAACAAGCCTGGTTCCCAGGACTCTCTCGCCTTGATATTGTCGTTGTTATGGCAGAATGCCCTGCGTATCAGCTCAAACGTCCCAGGCGCAAAGAAACTTTGTGTTATACTTCCCGATCAAGACAACAATGAAGAAGACGAGAAAGATCAGGAGAAAACCAAAGAAACAGTGCCTGTTCACGATGAAATGACGTTTAGTAAGGTACTAGAAGCATTCAAGTCCAGATTCCCGGACAACGGTGAAGGAAGAGAATTGTACCTCACTGATAAAAAGTCAGATCAGATACTTGAGGAGAGAGACCATGTGCGTGACGTGTACACGCACCGTAAGGGGTTTCCCAGCCCTTTGTTGCTGTTGGAGTACTTGGACCAAGAGTTTGCTTTTAACAAGAGACAAGCACAGGCGTTCACTACCAAGATAGCAGAGATTGGCCGCGTTCTACTGACGTCATCCATTCTGAATGCCTTACCCAATCAGGAACTTGCAGCTCTTGATGTCATTCATAAAAGTGTGTGGGTCAAGCTGATTACGTCACTCTTCCAGTGCATGTCCACGGATTTCCCGTGGAGCTCTGCGGACCTGAATCTGTTCCTGAATGTCATCAATGGCGCCATTTTACTTCACTGTGAGGACGGTGCTTTGCTGCGACTTTGCCTGGCGTCGTTTATAAACATTGCTGTTCATTTCAGTCACATATTCGCTAGCGATGGGTAA

Transcript

OS493_037574-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8BLN6	Protein unc-80 homolog OS=Mus musculus OX=10090 GN=Unc80 PE=1 SV=3
Q8N2C7	Protein unc-80 homolog OS=Homo sapiens OX=9606 GN=UNC80 PE=1 SV=2
Q9VB11	Protein unc-80 homolog OS=Drosophila melanogaster OX=7227 GN=unc80 PE=1 SV=5

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001978 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF20262 all species →	UNC80_C	Protein UNC80 C-terminal region	Repeat	Interproscan
PF19424 all species →	UNC80	Protein UNC80 central region	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR046460 all species →	Domain	Protein UNC80, C-terminal	Interproscan
IPR045852 all species →	Domain	Protein UNC80, central region	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR31781 all species →	UNC80	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005261 all species →	Molecular Function	monoatomic cation channel activity	Interproscan
GO:0030424 all species →	Cellular Component	axon	Interproscan
GO:0034703 all species →	Cellular Component	cation channel complex	Interproscan
GO:0055080 all species →	Biological Process	monoatomic cation homeostasis	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_037574-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_037574-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

8.8Max TPM

3.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	3.09	5.81
polyp at pH7 6	18	17	3.06	4.75
coral polyp · control treatment	16	16	4.59	7.79
coral polyp · oil and dispersant treatment	16	16	3.39	5.85
coral polyp · oil treatment	16	16	3.81	6.80
coral polyp · dispersant treatment	16	16	4.23	8.76
Polyp	10	10	0.96	2.39

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.81
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.34
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.42
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.27
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.06
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.00
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.98
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.88
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.86
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.84
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.82
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.69
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.67
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.49
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.47
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.25
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.07
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.69
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.75
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.72
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.43
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.39
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.29
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.99
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.80
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.59
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.08
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.01
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.94
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.93
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.24
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.14
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.14
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.57
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.11
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.79
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.49
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.12
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.88
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.47
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.44
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.79
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.58
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.47
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.43
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.79
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.36
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.75
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.80
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.69
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.58
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.85
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.32
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.11
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.90
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.80
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.39
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.42
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.11
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.89
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.54
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.54
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.44
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.20
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.74
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.56
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.45
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.80
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.77
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.68
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.11
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.05
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.97
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.72
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.11
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.49
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.97
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.78
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.77
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.58
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.29
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.58
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.32
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.76
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.73
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.85
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.57
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.00
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.95
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.79
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.49
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.32
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.90
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.90
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.51
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.67
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.57
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.38
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.30
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.39
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	1.42
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.23
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.96
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.95
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.84
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.57
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.55
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.48
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.23

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.