Gene detail

Detailed information of OS493_037633-T1 in Lophelia pertusa

Genomic Location: scaffold_442:59823...82619
NR annotation: KAJ7369607.1, Dynein heavy chain 14 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_037633-T1

ATGTCTGGGGGTGAGTGGTATTCTGGGACGTGTGGCGCTTATCTGATCAAGATGGCGGAAGCGAATTTACTTCTCGGTAAAGAAGTAGCAAGTGAGATTCGACAGAAGTTGAAGGAAGATGTTGCAGCAATCCGAGAAGAAAATGAAGCATTCAAACCAGGACTTGCCATTGTGCAGATTGGTGACAGGAGTGACTCTACTGTGTATATCAAGTCAAAAGTCAAGGCAGCTGAAGAGATTGGTATGTTTGCCAGGCATGTGAAGTTGCCGAGGACCTCCACTCAAGCAGATGTTCTCAAAGCTGTGGATGAGCTGAACAAGGATTCAACAATTCACGGCATCATTGTGCAGCTCCCCCCTGACTCTGAAGAGCCGATTGACCCTGCGATTTGCACGAATGCTGTGGCTCCAGAAAAGGATGTTGATGGGCTGCATGATGTGAATGCAGGAAAGTTGTCAAGAGGAGAATTAAATGACTGTATTGTGCCTTGCACTCCTAGAGGTTGCCTGGAGTTGATAAAAAAATCAGGTACAGAGATTGTTGGAAAAGAAGCAGTAGTCCTGGGAAGAAGCAAGATAGTGGGTTCTCCCATGGCAGATCTTCTCAAATGGCATCACGCTACAGTGACAACATGTCACTCAAAGACCAAAGACTTGCCAGATGTGGTGAGAAGGGGAGATATTGTCGTTGTTGGAATTGGAAGAGCTGACTTTGTAAAGGGGGACTGGATTAAGGAGGGAGCTGTGGTTGTTGACTGTGGAATTAAATGTGATTCCAGGTGTTGGGCCAATGACTGTGGCGATGTTGATGAACAACACAGTGGACCGTGCCAAGAGGGCTCTTCAAATGCAAAAGAATATCTCACCCGGAGACAGCCCGTGGATGCAAACTTTCGAATGTGGCTGAGTTCCAAACCAGACCCTTCCTTCCCAGTCTCCATCTTGCAGGCTGGACTCAAGATGACTGTGGAACCTCCTCCTGGCATCAAAGCCAACCTGCTGCGCTCCTTAGGGGGAGTGGGTGGAGTAGTGACCGAGTCTGTCTGGGAAGACTCGGGGCCTGGACCGGCTTGGAAGAGGCTTCTGTTTGGTTTGTGTTTCTTCAATGCAATCGTGCATGAAAGAAAGAAGTTTGGCGCCCTGGGATGGAATATCCCGTATGAGTTCACTGCCTCGGATCTGGAGGAAGTGCCTTGGAAAGCCATCAGATATCTGACAGGTGATATCGTGTATGGTGGCCGAGTGACAGATTACTGGGACCAACGCTGCCTGCAGAGCATCCTGGGAAAGTTTTACTCTCCAATGGCCTTACAAGAGAGTTATGGCTACACGGTGGACTATGTATACCGTCCACCACCCCCTGAAATCTCGTTGTCAGTATGCTGTGAGTACATTGAAGGTCTGCCTACTGTTGATGCTCCTGAACTGTTTGGTATGGATCAGAATGCAGGCACGGCCTTCCTCGCTAACCAGGGCAGAGCTCTCATAGCAGACCTGCTGGCCGCCCAGCCACGGCTCACGGCGGCTGTAGGTTCGAACAAAACCAATGATGACATTGTCCTGGATCTAGTGAGTGACACTTTAAAGTACCTCCCCCAAAGGGTGGACTCTACCTCCGATGGATTAACCGCTGGTCTGCTGGACCCAAGGCTCGGATCTGTCAGTCCAGATCGCCTGAGGCAGATGACTCAAAAGAAGCTGTCCCAGGATCCTTTGGCAGATCATGCTGATCAATCAGTATACGTCACGGTCTTGAGGCAGGAAATAAACCGGTTTGACCGGTTGCTGGGTATTATTCATACGTCACTCTCATCATTGCGATTAGCAGTTAAAGGAGAAGTGCTCATGTCTGAACAGTTGGAGGAAGCATACAATGCTTTGCTTTGCAACCGCGTTCCTAAGGCTTGGGAGCAAGCGGCGTATGAATCATGCAAACCGCTGGGAGCCTGGGTCGACAATCTGGCCAAAAGAGTGGACTTCTTCAGCGGTTGGTTAGACTTGGTCAGGAAAGACAAAACATCCAAGTCCCGGATGTCACGTGAATCTGGCGTCACATCAACACCAACGCCCAGCCAATCATCGATGTCCGTGTCTGCACCACGTGTTCACCCTAATGCTTTCTGGTTACCTGCTTTCTTTTTTCCTCAAGGTTTTCTCACAGCCATTTTACAAACACATGCTCGTGAACGTAACGTTCCAGTTGATTCGTTAAGTTTCTGTTACCGAGTATTGAACGAAAAGTGGACAAACCAAGAACTGGTTCACAGTGAAAGCAACGTTGATTTTAAACGAGTCGCCTTTCAGGTGAGAAAATGTCTCAAGTGTGATTGGGCAACTTAG

Transcript

OS493_037633-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9C0G6	Dynein axonemal heavy chain 6 OS=Homo sapiens OX=9606 GN=DNAH6 PE=1 SV=3
P27653	C-1-tetrahydrofolate synthase, cytoplasmic OS=Rattus norvegicus OX=10116 GN=Mthfd1 PE=1 SV=3
Q922D8	C-1-tetrahydrofolate synthase, cytoplasmic OS=Mus musculus OX=10090 GN=Mthfd1 PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001689 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00763 all species →	THF_DHG_CYH	Tetrahydrofolate dehydrogenase/cyclohydrolase, catalytic domain	Domain	Interproscan
PF18198 all species →	AAA_lid_11	Dynein heavy chain AAA lid domain	Domain	Interproscan
PF02882 all species →	THF_DHG_CYH_C	Tetrahydrofolate dehydrogenase/cyclohydrolase, NAD(P)-binding domain	Domain	Interproscan
PF18199 all species →	Dynein_C	Dynein heavy chain C-terminal domain	Domain	Interproscan
PF03028 all species →	Dynein_heavy	Dynein heavy chain region D6 P-loop domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR020630 all species →	Domain	Tetrahydrofolate dehydrogenase/cyclohydrolase, catalytic domain	Interproscan
IPR041658 all species →	Domain	Dynein heavy chain AAA lid domain	Interproscan
IPR020631 all species →	Domain	Tetrahydrofolate dehydrogenase/cyclohydrolase, NAD(P)-binding domain	Interproscan
IPR042219 all species →	Homologous_superfamily	Dynein heavy chain AAA lid domain superfamily	Interproscan
IPR000672 all species →	Family	Tetrahydrofolate dehydrogenase/cyclohydrolase	Interproscan
IPR041228 all species →	Domain	Dynein heavy chain, C-terminal domain	Interproscan
IPR036291 all species →	Homologous_superfamily	NAD(P)-binding domain superfamily	Interproscan
IPR046346 all species →	Homologous_superfamily	Aminoacid dehydrogenase-like, N-terminal domain superfamily	Interproscan
IPR004273 all species →	Domain	Dynein heavy chain region D6 P-loop domain	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR043160 all species →	Homologous_superfamily	Dynein heavy chain, C-terminal domain, barrel region	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR22878 all species →	UNCHARACTERIZED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004488 all species →	Molecular Function	methylenetetrahydrofolate dehydrogenase (NADP+) activity	Interproscan
GO:0007018 all species →	Biological Process	microtubule-based movement	Interproscan
GO:0008569 all species →	Molecular Function	minus-end-directed microtubule motor activity	Interproscan
GO:0030286 all species →	Cellular Component	dynein complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_037633-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_037633-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

114.4Max TPM

17.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	18.96	40.05
polyp at pH7 6	18	18	21.66	41.14
coral polyp · control treatment	16	16	19.46	114.35
coral polyp · oil and dispersant treatment	16	16	15.71	85.93
coral polyp · oil treatment	16	16	18.07	74.77
coral polyp · dispersant treatment	16	16	11.85	49.96
Polyp	10	10	19.32	51.14

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	40.05
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.63
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.93
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.10
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.81
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.76
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.71
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.87
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.36
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.15
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.08
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.81
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.17
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.71
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.86
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.86
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.79
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.71
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.14
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	40.40
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	40.32
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	40.11
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.29
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.91
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.57
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.19
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.15
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.66
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.27
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.73
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.19
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.10
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.88
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.82
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.76
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.37
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	114.35
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	61.90
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	56.47
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.29
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.37
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.39
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.33
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.04
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.31
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.19
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.68
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.79
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.00
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.31
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.21
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.71
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	85.93
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	61.96
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.88
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.82
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.66
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.20
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.99
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.88
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.30
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.13
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.05
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.97
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.83
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.58
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.20
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.02
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	74.77
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	59.08
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	57.67
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	44.56
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.79
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.00
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.07
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.69
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.49
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.06
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.03
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.19
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.13
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.45
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.13
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.95
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	49.96
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.01
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.34
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.46
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.22
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.17
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.34
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.31
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.08
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.03
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.47
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.23
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.00
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.15
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.12
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.75
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	51.14
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	48.43
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	32.22
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	23.95
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	11.98
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	5.91
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	5.77
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	4.69
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	4.58
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.51

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.