Gene detail

Detailed information of OS493_037730-T1 in Lophelia pertusa

Genomic Location: scaffold_455:47805...52400
NR annotation: KAJ7350210.1, hypothetical protein OS493_037730 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_037730-T1

ATGGTGCAAAGCTATTCATTGAAATCTGGCCTTCTGTTAGCCATAATTTTTCCTGTTGTGAATTTCTATGTTTGCTGTAAAGAATTCCAGCCTCTTAAACTTCATAGAAATAGTTTATCAAAAGTTGGATCGCAGATACTTTCTTCCCAAGAACGCATAGGATCAGGAGGAGACAGAATAAACGCTAATGTCGCTGTGCAAACGAAACTTACATCTTTGAACTATGATGAAATTCAGTTTGCCTATGGCTGTTTACATGACATTCCAAAACCAAATGTCACGTTAGATACAACATTCACACCCCAGCAAGAAAGAAATGTTCTTATGGAGATATTCAACCAAACAGCTGGTCATAACTGGAACAACAACACTCACTGGGGAAATGACTCGGTGTCTCACTGCTTTTGGTATGGAATTACATGTGATCACACCAATCGCTACATCATCAACATAATTTTAAGAAAGAACAACTTAACTGGAACTCTTCCACGAAGCCTGTGGAAGTTACGTAATTTGCAGGTCTTGTGCATTGGTAATAACAAAGAGTTGTCAGGCGATCTCAGGGAAATTTTGTCCCCCAATATGACTACCATACTACGTCTTGATCTTAGCCACAACAGATTGTCTGGTATCATTCCTGGTGAAATTTTGGTAAATATGAAGTCGCTGGTAAAAATCCGACTTTGCTGTCAAATGGATGACGGACTTACTGGTGAAATTCCAATGGACATTGGAAACTTGACGGAACTACAAATTCTCAGTCTCGGAGAAAACAGATTATATGGTTCAATACCGAAGAGCATTGCAAAATTGAAAAAGCTCTGGTTTCTGGATCTTGAAACTGCTACATATTTAAACAGCGGATTTGAAAACCTTTTTAATTTGTCATCTTTACGTTTCATGCACCTTTCTCTCGCTGGACTAAAGGGAACTCTACCTGACGAATTTGGATTGTACTTTCCTGAAATGATCGAGTGTCTCTTGGCAGGAAATCATTTTACCGGAAACATTCCTTCAACAATGGGAAACATGACAAACTTACAGCATTTAAACCTAGCAAGGAACCATCTTTCAGGTGAAATACCCAAATGCATTGGTTTAATTCCTACGCTTCAAATTGTCAACTTCTGTGGGAATCAGCTATCATCATTCGAGAAAGGAATTAAGTTTATGTCACTAGAGGTACTGCTGCTTGCTAGCAATAGACAGCTCACTATGAGTTTCAATGTACTCTTAGAAGCGATGGAATCGACAAAAGGATCGTTGCGTATTCTTAGCATCCGCGACTGCAACTTTCTGGGCACAATCCCAGCGATGCTGTGGCACTTTAAAAACGTAATCTATATAGATTTAAGAAATAACAGATTGACTGGAAAGCTTCCGTGGTCCTATGAAAACTTGTTATTTCTCCACGATCTCCACGTTTCCGCGAACAACCTTTCGGGTCAAATTCCTGAACCGTATGTGGACCTACCTTCTTTGGAAGTCCTTGACGTTTCAGAGAATCCTTACATGCATGGAAGTGGAACTTTACCCAACTATATGAGGGTTGACTTTACAACGTTGACGCGCAGACATCCTTCAGATCAGTTCAAGTGTCCCAATGCTCGTCTCAACCATAACAATGGATTGGTGGTTTTAGATCCTAGCTATTATTTTTACAGTCTGTGCATTTGCGACATTGGATACTATGGATCAGGTAAAATCTGCTTACCTTGCATGGAAGGCGCAGTGTGTGAAGATCAAATGATTCCTGCTCAGAACATGGTCATGAAAATGGGATTTTGGCCATCATCACGTCATCAGAACGTGAGTCATCTTGTTGACTGTTCACAAGCTTTGGGTACAAGTCCCCACATAAACACATCATGCAATCCAACGGGTGCTTGTGACTGTTGGATTGATAATGAATGGATCAAAGAGGGAGACATGGCAAACATCAGGCCATCCACCGTTTGCAACAAGTCGTGTCTCTGCCTTACAGGTAGTAAAGATCGGTTTTGTTCACTCTGTGAAGATGGGTATTACAAACAGGGGATCCTTTGCTACGCCTGCCCAAAAACTGAGATCAGTGTCTACATCCTGGCTGCACTTGCTGTCCTGACCTTGGTATTGATAACTCTTACCTTTTTTCTGTACGAGAAGAAGCGTTTTCTTTCCATTGTATTTGTCTTTTCTCAAATCATTCTTTTAGCGGTGTTAGCCATGCTTCGCATCATTCCAGGCTGGCTGCTTGAACTCAACACAGTAGTTCTCTTTGTTGGTTTAGCGGAAAGAGGTAAAACTGCACGAGGGATTCTGAAGATCAGCTTGTTTTATTTACAAACCCTGGACGCTTTGATTTCCAACAATGATATCTGGCCGATTGAAGCTCTTCAAACTCAGCGCTACATCAGCAATGTGTTTAACTTCCGTTTCTCAGGTTTGGCTTGTGTAATTCCTCGCTTGTTTACACCACTTGGTGAACTTGTGTCTCTTGTTCTTCTCCCTGTTTTCTGTATCTTGGGTATTTGGTTGTGGTATGGTCTTGGGTGCCTCGTGTGCACTGTGCTTAGACTTCGCAATTTGCAAGTAAGGCGATTTCGATTACGAAATACCTGTTTACAACTTTCCATCGTGTCTCTTAACCTCACCTATTTTCCCATTGTGAAGAAAACGGCTTCTGTCTTGGCTCGCTGCGGAGAGGACAACAATTACCATTACTTAAGGGAGGCACCGTGGATGGAGTGCGAAGGTCATGTATACACCATCCTGCAGGTGTTAGGCTGGCTTGCGTTTGTAATTTACGTGATTGGGGTCCCTCTTGGAGTGTTCTTACCTCTTCTGCGGGTATATAACGTTTCTACCAGAGACCAACTGCCTCCAGAAGAACAAGAAACTTTGGATAGTTGGCTAGGTTCCATCTACCTGCCATATAAGAAAGAATTCCGTTCCTTTTTTGAGATATTCTTCATTTTAAAGCGCATGCTAATCGCATTCTCGCTTTCTCTCATCACGCGGGCTTCGTCATTCCAGACGATAGCAGTTTGCTTTGTATTGTTGGTTTCCCTGTGCTTTCAGCTTTTCTTCAGGCCGTTCAATGATTCTTTGGAAAACACCGTGGAGGCCTTGGTTCTTTTGACTCTTCATTTCTCTTTCATGAACATCAGATATGCAGTTCTGAACCCGGACTCGTCTGCGCCTATTGTTTGGATGCTTGTGACGGTGAATTTAGTTATTCTTTGCGGGATAGTTGTTTCAATAATTGTACTCTTGGGGAGGAAAAATGCAGTAGAAATGCCCCTTCTGATGCATGAAAGGGCCGAAGACATGGAACTCACACCGATCTGCCAAATAAATTCTCCTTTGTCATCGCTGGTTAGGAATGGACCGGAAGAACAATATGAAACGTTCGATGACTCGTGA

Transcript

OS493_037730-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000817 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00560 all species →	LRR_1	Leucine Rich Repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR032675 all species →	Homologous_superfamily	Leucine-rich repeat domain superfamily	Interproscan
IPR001611 all species →	Repeat	Leucine-rich repeat	Interproscan
IPR051716 all species →	Family	Plant receptor-like serine/threonine kinase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR48053 all species →	LEUCINE RICH REPEAT FAMILY PROTEIN, EXPRESSED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_037730-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_037730-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

106TPM > 0

7Conditions

3.8Max TPM

0.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	0.75	1.29
polyp at pH7 6	18	16	0.63	1.19
coral polyp · control treatment	16	16	1.18	2.34
coral polyp · oil and dispersant treatment	16	15	0.73	1.71
coral polyp · oil treatment	16	16	0.91	1.75
coral polyp · dispersant treatment	16	15	0.66	1.43
Polyp	10	10	1.38	3.83

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.29
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.20
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.13
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.99
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.93
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.86
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.85
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.77
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.71
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.71
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.70
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.68
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.67
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.60
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.54
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.34
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.29
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.21
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.19
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.19
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.14
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.79
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.74
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.68
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.68
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.64
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.60
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.60
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.56
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.55
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.54
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.53
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.53
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.34
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.34
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.78
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.72
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.68
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.68
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.55
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.50
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.41
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.40
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.98
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.62
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.62
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.58
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.35
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.35
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.34
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.71
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.33
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.25
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.06
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.84
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.80
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.70
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.65
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.60
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.57
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.56
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.51
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.48
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.45
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.06
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.75
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.68
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.48
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.29
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.25
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.18
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.12
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.96
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.70
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.53
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.53
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.51
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.42
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.40
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.38
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.36
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.43
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.43
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.25
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.99
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.91
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.85
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.80
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.71
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.52
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.46
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.35
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.35
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.30
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.20
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.06
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	3.83
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.81
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.98
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.82
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.55
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	0.49
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	0.48
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.40
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.22
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.21

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.