Gene detail

Detailed information of OS493_037788-T1 in Lophelia pertusa

Genomic Location: scaffold_461:136643...146473
NR annotation: KAJ7350208.1, hypothetical protein OS493_037788 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_037788-T1

ATGTCGCTGAGTGAGACAGACACATATCCTTCTCCTACGCCGTTCTCCATCTTTTCATGCAGAAAATTAAAATGCCCTCCTGGGTTTTCAACCGTTTGCGACGAAAGTGGAAAATCTCGCTGCGAACGATGCGTGGAAGGGACTTTCACCGAGAACCACTCGCGCCGAAAAGATTGCCGGCCTTGCACCCGCTGCCGTGACGACCAATTTGAATTGAAACCATGTACTCCAACTTCAAATGTCATCTGCAAAGAATGCAGCAAGTGTGATCCAGGCTTTGGTGTGTTGAAGCCTTGTGAAAGAACAAGAGACACTATTTGTGAGAAGTGCCGCCCTGTTGCTGAGGACGGAGTCATCAGTTACCCTAACATAGAATGCAACAGAGGCGGAAGTGGAGATCCTGACTTGATCTTTGGGAAGAGCAACGAAAAAGAAAAACCCAAAGACTCTATGACAATAATAGAGGTGGAGAGACCATGGCCAGATGTGAAAAAAGAACCCAAGCATCAACAGAAACTCACGGTCGATGAAAAGCATGGAACAACGATCGTCTCAAGTTCGCGCGGGTTTCCATCAGTTAACCCAACACCTTCAAGCTCATTCTCAACAAATAGCGCAGCAACTCAGAGGACGACATTTTCATCAGATTCTGTGGGTTCGGTTTCGTTGTCTATAGTAGCTTCATCGAAATCTATTACGGTTGTCTTGGGGAAATCAATCGGCCCGTCTCTCACTCCAGCGATTCCTACCGAACGACAATCTCCGCCCAAAGTGCAGCGTACCAAGGCAACAGAAAAGCCGGAATTCCACATCAACACGGGAGAGCCGCCCAGCGATGGCATGCAAGGAGACGATCCTCATGTTGCAAGGCATACACGACGGAATATTCAACAAAACAGTTCAACTTCATTGAAACCGAGGGAAAAGTTAGCATCGTCTGTTTCACCAGGAACTGCAAACATGTTCGATTTGGTTCACCGCGGAATGACCGAAGAACATAGCACGGAGTTCCGCAAGCATTTTACCTCACAAAGTGGATGCCTCTTTAATTGTCCCCGGCCTAAATGCAGACCACCTCGTTGTACTGGATCGTCAGACTGTTGTGATAGTACCTCTTTATCAAGTGATGCAGAGGTGTATACAGAACAGAATGGAAATCAGCCCGTGAGCGTAATCACTGAAAATGATGATTCACTTCCTAACTCCAACAACACAACTCTACACACGTATCTCCCCTCTGAACGCACGACTGTGGTGGCAGATGTTCATCATAACACGGTGTTTGATTTGTTTAACATCAGGGAACAACTGGAAGGAACTACAAGGCCCTACCCAGAGTATATCACACAGGTAGAGGCTACATTCAACAGCTCGGGCGGGAAGTTGTGTGCCCCAAACTCGAATGTCAGGATCATCGTTGACAGTGGAGCAGTCCCCGAGGGAATTAACCAGCCTTTCTTCTTCCGCGTCGTCTACGATGAAACATCACTGTTGCGGGATATCCCGGAAACACCCGATAGTTCTCTCATTTCCCCAGTGATCCAGTGTGGACCGGAGGACATTAACCTGCTAAAGCCGGTGGATGTTGTTGTTCCACACTGCCTGTACGTGGACGAAGTTAAGAAGGAATGGATAACTGTTTACAGATGTTCGCATTATTCAGACGAAGGCCCGATCAATTGGGAGAAAGTTCCCTCGGCATCGGAGAAAAACTGCCAGTCCAAAGCATGGTTCACGGTGAAAAAGGACTCCATTCACATCAAAACCAAGGTGTTCTCATTCTGGAGCATCTTCGCCTGTGGTGGACCAAAGAAGAAGAGAGCGACTGTTTTCTCCAGCAGACCGAATCCAAAAAGCAGCGATCTGATTTACCTGCGATTCTACATCTACAGTGATAACGAGGACTCTAAGAAGAGAGTGGAGGTAAGAGAAAGAGAACGGTTTCCAGACTCGAAGGCAGCGAAGGAGAAACCGTTCAAAATGTACAATGACGATAACGACATCACAGTGAAACTCACTGATCTTGAAGAAGGATGGCAACTGGACAAGACTGACAGTAGTCAGACATACACCTGCGAGACGGCCTATCGGAACGGATTCCGCTCCAAAGACTCGTGCGATTTCGTAGTGAAACCAACGAGTCAAGGCGTGAACGAGTTTTCGTGTATTTTGAGGTTTCAGCAGGAAGAGCACACCCCAGAGCATACCATCTACCTTAATCCAGGATTTACTCCACGGCAGGTAAAGTAA

Transcript

OS493_037788-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001790 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00020 all species →	TNFR_c6	TNFR/NGFR cysteine-rich region	Domain	Interproscan
PF00791 all species →	ZU5	ZU5 domain	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001368 all species →	Domain	TNFR/NGFR cysteine-rich region	Interproscan
IPR000906 all species →	Domain	ZU5 domain	Interproscan
IPR009030 all species →	Homologous_superfamily	Growth factor receptor cysteine-rich domain superfamily	Interproscan
IPR037936 all species →	Family	Netrin receptor UNC5	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12582 all species →	NETRIN RECEPTOR UNC5	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005042 all species →	Molecular Function	netrin receptor activity	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0038007 all species →	Biological Process	netrin-activated signaling pathway	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_037788-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_037788-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

53.9Max TPM

16.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	15.06	26.38
polyp at pH7 6	18	18	15.07	26.08
coral polyp · control treatment	16	16	23.91	53.90
coral polyp · oil and dispersant treatment	16	15	13.78	20.55
coral polyp · oil treatment	16	16	14.34	24.36
coral polyp · dispersant treatment	16	16	20.37	37.06
Polyp	10	10	8.61	22.15

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.38
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.99
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.61
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.87
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.67
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.11
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.50
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.35
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.98
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.90
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.80
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.48
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.47
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.94
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.22
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.95
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.04
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.92
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.08
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.51
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.41
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.19
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.31
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.44
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.44
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.36
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.54
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.34
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.14
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.66
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.71
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.48
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.78
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.37
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.03
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.47
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	53.90
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	47.22
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.55
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.24
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.37
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.86
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.53
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.09
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.35
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.65
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.80
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.70
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.90
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.23
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.07
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.06
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.55
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.77
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.92
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.72
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.18
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.42
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.11
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.08
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.03
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.52
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.19
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.37
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.22
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.44
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.95
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.36
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.48
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.05
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.49
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.61
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.48
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.82
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.86
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.38
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.37
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.52
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.86
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.14
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.02
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.76
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.33
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	37.06
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.09
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.80
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.24
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.87
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.56
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.55
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.47
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.40
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.43
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.24
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.38
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.75
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.42
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.62
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.97
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	22.15
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	10.21
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	10.03
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	9.40
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	8.26
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	7.91
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	6.56
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	5.57
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.53
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	2.44

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.