Gene detail

Detailed information of OS493_038324-T1 in Lophelia pertusa

Genomic Location: scaffold_555:30132...39241
NR annotation: KAJ7375871.1, hypothetical protein OS493_038324 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_038324-T1

ATGGCAAAGCGAAAGAAAGGAATTTGTAGAGGCCGAGTATGTCTAGTTGTTTTTCTTGTGTTTCTGGCAGGAACATCGTTATTGAATGTAATGTTTATCTTACAAACCACTTCGCGAACAACGAGTGCCGAAAAAGAACCGATGGAATACGACGTTCGATTTCACAGCCTTACAACGAATTCCGTTTCTTCTTCGGTAAATTGGACGAAAGAGCGGAAACCTTCGTCATCCACCGGGACCGCAGGCAGCTGCAACGATGTAGGAGGAAGACTGGACACAAGTCGAGCCCCACACGGAGCTCAAGTTTTGGCGAATCGATCCCAAAACAAGAGAGCCTGCTCACAGGCTAATGCTGCTCACAGGCTAATGATGTTTTTAAAAGAAAGTCACTATCTGGATATAGAAGTTTTATCAAGCAAAGAGAATGTGACCATCACTATAAATGGACAACAGCGGGTGGACACTTCCGAGATGTTATTGAGGGGACTGAACGTGATGGTTTTAAATGAAGTGACTGGCGCGGTAATGTCCTCCAGATGGTTTGATACATACGAGTCCAAAGAGGACAGCGGTTTTCTTATGGAATTTCTGAAAAGTTTGAAACCTGGCAGAATAATGTGTTTTGCTGTAAAGGATGAGGCTTCTCTTTCCCTCTCCAAAAATGCTCGTATGTTCATCAAAAGTTTGGGAAGCTCTTACATCAATCAGCTCAGATGGAGAGGCATGTGGGCGTTCGTGGTTCAACGATTGGACAATCGCAACATCGTGTATGGGGAGAGCTTCCAGGATTCACCGGAATATAAACAATGGGGGAAACCGGTAAAACTGCGCACATCAGTGAAATTACTGGCAGAAAGTAATGTCAACTGCAACTGGAAGGACTCGGACGTCAGCAGAAGACGAAGAGAATTCTGTGATAAATATGAAGGATATGATCGCGTATGCAATTGTTATAATCCCTTGTCTCTGGACTTTAACCCGCCCGCTTTTAAAGATGGCAGCCGACTCAAGCTTCCATTGGCCGTCATGGCTGGTAACAGACCGACCTACTTACTGCGCATGCTCTTAAGCTTGCGCAGTGTTGAAGGCCTGGATCCTAGCTTAGTGACTGTTTTTATTGATGGATATTTTGACGAGCCGTCGTCGGTAGCCAGGTTGTTTGAACTGAATGTGGAACAGCATGCTGGCTCAGGGAAACGCAATTCCAGGATTTGTCAGCATTACAAGAAATCATTAACATGGTCGTTTGACCGATATCCTGATGCAGATTACCTGGTTATCCTGGAGGAAGATCTCGATATATCTGTTGATATTCTCAGCTACTTTAAGCAGCTTCTCCCTGTCTTAGAAAACGATGAAAGTCTGTACTGCATATCAGCTTGGAATGACCAGGGTTATGACCATCTTGCTAATGACCCGGCAATGTTATACAGAGTTGAGACTATGCCAGGGTTAGGATGGGTTCTAAATCGTAAATTATACAAAAACGAGCTGGAGAAAAAATGGCCGAGGCCCGATCAATCTGCTGACTGGGATATGTGGATGAGATTACCTTCCAACCGAAAGGATCGGGAGTGTATTATACCGGATATATCTCGTACTTATCATTTTGGAGCCAAGGGACTCAATGTGGGAAGCTATATGCAAAACATTTACTTCAAACAACACGCGTTAAACAACGAGACTAACGTGAAATTAGATGTGGAGAAGATGTACAAGAACAACTACGAGAAAGAGATAGTTCGTTTGATAGGAGAAGCCAAGCTTTTGAATCATTCTAAAAACCCGTGCGCAAACCTCCAGGACTTCGTCCCAGACTCCGCGGGAGAGACGTACTTGTTTTATCTGCGTATGAATAACCCCAGGGACTATACCACGTGGTCTAACGTGGCGCGGTGCTTTCGAATGTGGGATCTGGACCCGAGAGGTTTTCATAAAAGCATGTGGAGATTCTGGATCAAGAAAAATCATATTTTAGCGGTTGGATGCCCCGCGTCTGTGTATTGTAAAAACAAACCACAAGATTTAGAACCGATTTATCTTCCAAACAAAGAGACGAGACCGAAAGATCCTGTTTAA

Transcript

OS493_038324-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5EAB6	Protein O-linked-mannose beta-1,2-N-acetylglucosaminyltransferase 1 OS=Bos taurus OX=9913 GN=POMGNT1 PE=2 SV=1
Q8WZA1	Protein O-linked-mannose beta-1,2-N-acetylglucosaminyltransferase 1 OS=Homo sapiens OX=9606 GN=POMGNT1 PE=1 SV=2
Q5RCB9	Protein O-linked-mannose beta-1,2-N-acetylglucosaminyltransferase 1 OS=Pongo abelii OX=9601 GN=POMGNT1 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000939 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03071 all species →	GNT-I	GNT-I family	Family	Interproscan
PF15711 all species →	ILEI	Interleukin-like EMT inducer	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR004139 all species →	Family	Glycosyl transferase, family 13	Interproscan
IPR039477 all species →	Domain	ILEI/PANDER domain	Interproscan
IPR029044 all species →	Homologous_superfamily	Nucleotide-diphospho-sugar transferases	Interproscan
IPR052463 all species →	Family	O-linked-mannose beta-1,2-N-acetylglucosaminyltransferase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46396 all species →	PROTEIN O-LINKED-MANNOSE BETA-1,2-N-ACETYLGLUCOSAMINYLTRANSFERASE 1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006486 all species →	Biological Process	protein glycosylation	Interproscan
GO:0008375 all species →	Molecular Function	acetylglucosaminyltransferase activity	Interproscan
GO:0016266 all species →	Biological Process	O-glycan processing	Interproscan
GO:0030173 all species →	Cellular Component	obsolete integral component of Golgi membrane	Interproscan
GO:0047223 all species →	Molecular Function	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K09666	POMGNT1; beta-1,2-N-acetylglucosaminyltransferase	EC:2.4.1.-	Glycosyltransferases	ko01003	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_038324-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

9.6Max TPM

3.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	3.24	5.61
polyp at pH7 6	18	17	2.21	4.63
coral polyp · control treatment	16	16	4.18	6.67
coral polyp · oil and dispersant treatment	16	16	3.14	9.61
coral polyp · oil treatment	16	16	4.01	8.75
coral polyp · dispersant treatment	16	16	2.98	7.17
Polyp	10	10	3.66	6.51

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.61
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.21
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.54
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.74
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.52
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.50
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.46
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.97
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.80
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.79
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.77
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.69
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.65
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.55
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.55
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.40
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.33
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.28
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.63
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.17
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.07
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.75
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.58
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.41
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.26
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.21
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.05
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.01
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.97
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.88
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.86
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.84
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.59
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.38
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.14
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.67
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.75
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.75
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.30
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.24
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.22
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.78
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.77
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.25
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.62
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.57
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.29
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.68
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.57
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.09
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.36
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.61
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.18
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.64
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.31
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.13
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.04
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.68
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.60
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.56
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.07
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.03
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.93
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.77
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.39
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.27
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.96
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.75
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.09
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.82
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.10
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.76
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.12
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.70
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.51
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.38
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.24
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.22
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.22
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.51
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.51
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.25
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.04
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.17
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.98
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.53
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.03
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.98
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.74
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.93
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.20
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.10
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.09
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.05
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.99
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.60
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.91
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.74
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.61
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	6.51
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	5.81
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	5.66
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	4.45
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	4.45
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	3.96
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.24
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	1.35
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.67
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.51

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.