Gene detail

Detailed information of OS493_038509-T1 in Lophelia pertusa

Genomic Location: scaffold_605:10099...27408
NR annotation: KAJ7350094.1, Bifunctional heparan sulfate N-deacetylase/N-sulfotransferase 1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_038509-T1

ATGCGAGTAATTACACGAGTGAAACGACTGCGATTCTCTCGGAAAGTCTGTTGGGCTGTAATCCCTGTTACCTGGTTGGTGTTTTTCATCACGCTGTCGTTATACAATGATCGTGAAGTTGCTGACAACATTATAGCCACAGAGTTAAGCAAAGCCGGCTGGAAGACCACGTACCCAGATGAAACAAATGAACTTTATTTCGACGACTCGACACTGTCGTCGGCACGATTTGGCAACAGGACATTCAAAGTTCAGAAGAAAATATTGCTAGTTCACAAATCTTGGACGAAAGAGCGTTCAAAACTTTCTCACTACGTTACGCGGTTTCTAGACGGTCTACGTACGCCCTATGTTATAAGCGAAGTGGACGATAGACCTTTCTTAGACTTTAAAGAAGATCTTAAACCGGACGCAGCGGTTGGGAGATATTCGCTGATAATTTTCGTCGATATCAAGACTTATCTAGAACTCAAACCCAATGTTCAACAACTAGTGAAGCTTTACTGCAATAAATTTGCTTCGGGTCTTCTGTTTTTTATATCAAATCACGTAGGACTTATACCGGAATTTCGAATCGAAGTTATCAAATCGCAAAAGGAGAGACAGACGATAGACGTTGAAGTCAACGAGAATTCGAAACTTTTACGTATAACTCGGCGAGGTGGTTCGACCGTGAAGCCGTATGTGCCAAAGGGACAGGGAACGAGGTGGAGCTTTCTTCGATATGATCCAAGAGAGGTTCATTACGAGACAGTTGAATATGCGATCAATCGCAAAAAGCGGCGGAAACGCGAGCTGGACATCGCAGCAACGGAACAAGCGACTGTTTTGCTGGATGATGGACGAAGAGACGGGGTTAAAAAGGTGTTTTTCGGCGGAGGTTTTCCGTTTTTTCTACACACCATGCTATTTATGGACAGTTTGGAATATTTATCGCCTGTTAGTCCTGTTGCGTTTTCGCTTGAGAGATATCTGCAAATTGATGTGGACGATATTTTTATCGCCAAGAGTGGAATAAGAATGAAGAAAAAAGACGTTCTGGAGATGATATCAGTTCAGGAGAGGCTGTCACAAAAAATTCCCGGATTCAAGTTCAACCTGGGGTTCTCGGGTCGCAGCTTCAAGCAAGGAGATGAGGAAGAAGATGAAGGCGACGATTGTCTGGTTGAGCATGCGCATCAGTTCACGTGGTTTGGTCATTTGTACGATCACGAGCAGCCTCATAAACACACGTACGATGAGATTGTCAGGTCACTTAACAGGAATGAGGAGTTTGCCAAGAAACATGGCATTCCCATGAACTTGTCGTACATGGTGGCTCCACATCACTCGGGCGTGTATCCAATACACGAACCGCTTTACGATGCGTGGGCAAAAGTCAGGCAAGTACGTGTGACTTCCACTGAAGAGTATCCACACTTAAAGCCTGCTTGGTTCAGACGAGGATTTATCTATAAAGGAGTACAGGTGCTTCCCCGTCAAACCTGCGGCCTGTTTACCACAACTAACTTCTTTTACGAGATCAAAGGAGGGAAGAAGGCGCTGGACAGAAGTATCGAGGGCGGAGAACTGTTTGAAACCCTTCTGCGAAATCCAGTGATGGTTGTGATGACGCACATGACAAACTATGGCAATGACCAGTTAGCGCTGTACACGATCAGTCGGCTCGTCAACTTCGTTCACCGGTGGACAAATCTCGAGTTAAAATACGCCTCGCCGATTGAACTCGCTGATATCTACTTCAATTTATTTCCAAAGGATAAAGTTCCAGTGTGGCTGAGCCCGTGTGACGACAGCCGCCATCTTCAAATCTGGCCCAATCAGAAGTCTTGCAACAGGCTCCCCTCATTTCTAGTGATCGGGCCTCCGTTTGGAGGCCTGGGCGTTCTTGTGACACTTCTTAAACTTCATCCGGAATTCTTGCACATAATCAGCCCAAACAACACGACACAAGGAACCAGCTTCTTCAACACGGATAACTACATGAAAGGAGTCGATTGGTACATGCAATTTTTCCCTCGCCCGACAAGACTAGAGCAGATGTCGTACGAAGTAAGCGATGAATATTTCACCAATCACGACTCGCCGTACAGCGCAAACAATCTCCTCAAGTCCGCTAAGATACTGATCGTCCTTGAAGATCCTGTCAAGAGAGCTTTCTACCATTATCAGCTACCAAGTTTTGACGATCTCGTCAAATCCAAAGGCGATCCCAGTCTCTCGGACGTCAGGCGAACTATTTTGGAGGCTGGGCACTACTCTGAACACATCGCTCGGTGGATGAGATACTACAACGCCAAACAGATGTCCATTGTGAGCGTGGATGATTTAGTTTCCAGGCCCATCACGGTCATGAATACAATTCAAGAAGCCGTTCATGTAGAAACCCGCGTGGAGTACTCACAAGTTCTAAGGTACGATGAATCAAGTGGTCTCTACTGTCCCATATCTTCCACTAACGTCACGGATTGTTTGGGGTTCAAGGAATCCAGACCAGTGCACATGAGCCAGCAGACTGAACAGTATCTCCAGCGGTATTACTCCAAGCATAACCAGAATCTACTGCGCATGAACCAGAAGATCGAGTTTCCCTTGCCCAAATGGATTCATGGGTAA

Transcript

OS493_038509-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9EQW8	Bifunctional heparan sulfate N-deacetylase/N-sulfotransferase 4 OS=Mus musculus OX=10090 GN=Ndst4 PE=2 SV=2
Q9H3R1	Bifunctional heparan sulfate N-deacetylase/N-sulfotransferase 4 OS=Homo sapiens OX=9606 GN=NDST4 PE=1 SV=1
O95803	Bifunctional heparan sulfate N-deacetylase/N-sulfotransferase 3 OS=Homo sapiens OX=9606 GN=NDST3 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002036 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00685 all species →	Sulfotransfer_1	Sulfotransferase domain	Domain	Interproscan
PF12062 all species →	HSNSD	heparan sulfate-N-deacetylase	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000863 all species →	Domain	Sulfotransferase domain	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR037359 all species →	Family	Heparan sulfate sulfotransferase	Interproscan
IPR021930 all species →	Domain	Heparan sulphate-N-deacetylase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10605 all species →	HEPARAN SULFATE SULFOTRANSFERASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0008146 all species →	Molecular Function	sulfotransferase activity	Interproscan
GO:0005794 all species →	Cellular Component	Golgi apparatus	Interproscan
GO:0015014 all species →	Biological Process	heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process	Interproscan
GO:0015016 all species →	Molecular Function	[heparan sulfate]-glucosamine N-sulfotransferase activity	Interproscan
GO:0019213 all species →	Molecular Function	deacetylase activity	Interproscan
GO:0016787 all species →	Molecular Function	hydrolase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_038509-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_038509-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

29.6Max TPM

13.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	14.27	21.49
polyp at pH7 6	18	18	16.27	22.94
coral polyp · control treatment	16	16	15.99	23.76
coral polyp · oil and dispersant treatment	16	16	15.30	29.56
coral polyp · oil treatment	16	16	16.81	27.98
coral polyp · dispersant treatment	16	16	8.26	17.61
Polyp	10	10	4.28	12.60

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.49
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.40
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.47
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.91
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.59
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.97
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.64
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.27
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.47
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.43
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.17
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.81
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.79
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.37
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.93
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.73
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.33
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.14
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.94
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.05
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.74
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.57
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.17
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.34
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.36
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.45
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.28
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.42
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.92
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.91
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.77
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.53
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.07
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.62
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.86
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.86
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.76
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.15
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.10
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.01
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.94
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.90
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.44
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.22
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.09
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.01
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.91
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.44
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.72
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.58
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.65
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.84
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.56
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.89
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.10
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.47
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.45
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.04
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.82
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.48
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.93
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.62
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.20
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.94
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.18
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.75
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.60
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.76
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.98
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.55
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.95
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.88
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.98
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.97
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.63
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.27
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.92
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.01
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.40
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.55
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.46
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.21
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.44
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.71
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.61
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.40
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.57
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.91
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.23
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.07
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.54
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.97
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.90
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.76
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.65
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.08
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.01
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.73
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.96
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.77
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	12.60
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	5.83
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	5.73
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.50
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.45
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.43
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.24
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.65
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.25
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.14

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.