Gene detail

Detailed information of OS493_038798-T1 in Lophelia pertusa

Genomic Location: scaffold_726:17694...36328
NR annotation: KAJ7315272.1, Nucleolar complex protein 3, partial [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_038798-T1

GTTCCAAGTGGTGCAAAGAAAAGAAAAAGAAAAATAGAGGAGGAAGAAGAGGCTGATTATGAGAAGAGACCCAGATCAGCGCCAGCAGAACAGGATCACAATGAAAGAGCTCTGCTACCCATCAAGAGTAAAGACAGCATTATACAAAGGAAAGAGAAACTACCCCAAACAGATACTCCTTTGCAGAGTGAGAAAATAAATTCAGAAGAACAAGTCCCAGAAGAAGCCGATCAAGTGTCAGGGTCCCCACCAGCCCCTCCCCCAGTCTTAAGTATGGTTGAACTGTTCAATCAAAGAAGCCAGAAGCTTAGCCAAAGAAAACTTAGAATTGCTGAGTTATCAAACAATATCTTGGAAAACCCAGAAGGCAGTGTATCTGAGCTTCGGGAATTGTGTTCCCTATGTGATGAGAAGGATGCAGATGTCAGAATAACCACCAAAAAGCTGGCGATGGTTTCTCTATTGACTGTGTTTAAGGATATCATACCTGGGTATCCAATTCGAACATCTTCAGAAAAAGAGCAAGGTGTAAAGTTATCCAAAGAGGTTAAAAAACTAAGAGAATATGAGGAAGGCCTATTGAAATACTACCAGCAATACTTACAAATCTTGGAAGAAACTGTACAAGTGTGCATAAAGCATCAGAAAACAGCTGCTACTAATGGTGTGGTACAGAAAAAGATTGCATCTGAGAGTTTGATGCTTGTAGCAGTCCAGTGTATGTGTGATCTTTTGACATCTTTGCCCCACTTCAATTTTCACACAAACCTTGTTGCAGTTCTTGTACCTAGAATGAATGATAAATTTCTGGATGGCCAGATTTCCAAGTTCTGCTGCAATGCTTTTATCACATTGTTTAAACAAGATTCTGTTGGAAGTGTTTCTCTAGAGGTTGTGAAAGTTATCAGTAAGTTTGTGAAAAGTAAAGGATTTAGAGTTCAATCTTGTGTTTTGGAAACATTGCTGTATTTGAGGATTAGTAACATTGACATACAGTCGCTTCAACAACACAATGAGAAGAAATCTGCAGTGGAACTGAAGATTGAGAAAAACAAGAATAGAATGGAAAAGAAACTGAAAGGAAAGATGTCCAAGAAAGAGAAAAAGAGAAAAAGGGAAATGAAAAAACTTGATAAAGAACTTCAAGAGACAGAAGCTGTTGAAAGCCAACAGAAAAGAGCAAAACTGCAAACGGAGATCATCAAGTTCGTGTTTGTGATTTATTTCCGGGTTTTGAAGACAGTTGGACACTCCCCGCTGCTGTCTCCTGTTCTTGAGGGACTCGCCAAGTTTGCACACCTCATCAATGTCGACTTCTTTAATGATCTTATGGCAGCACTTCAGACACTTTTAAGCAACAAGGAGCTGACCCTCAGAGAAACTCTCAATTGTGTACTGACAGCATTTAAAATTCTATCTGGTCAAGGTGAAGCACTGAACATTGATCCACGAGGATTCTATTGCATGTTGTACGTATCCCTACTGCAAGTTCATGTCGGGTATAGCAGCCAGGATGTTCCTGTCGCATTGCAGTGTCTAGAAGAAATGCTTAAAAGAGACGAAAGCAGGTTCCTATTCAAAGAGTGGCAGGTTTTTGTTAAACGTCTTTGTACTGTAAGTTTACAGTCACAAGCAAACAGCGCACTGGCTTTTCTAGCCTATGTCAAGTCATTTCTTCAGTCTCACACTAAAGTTCAAGCCCAACTTGACAGTGAAAGCATGGGCACTGGTGTGTTCAGATCTGACGTGAATGACCCAGAGCTTAGTAATGCTGATAGCACGACCGCATGGGAATTGGCTCTTTTGGGAACTGGGTACTTTCACCCTGCTGTACGGTCACCTGTGGATTTTTGGCAAACTTATGATGCGACAGAAATGAAACTTAACCCTGACTTGACCGAGAATGCGCTAAACAAGAAAGCAGTCAACTTTAAAAGAATAAAACAGATGGAGGATGGAGAATGGAAAAGCTCTGATATGGTATCAGCTGTGACAGCAGCACTGGACTTTACTGAAGCTAGCAGCAGCGGAGTACAATTCACTTTACCAATGCATACTTTGGAAAGGTAG

Transcript

OS493_038798-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6DRN3	Nucleolar complex protein 3 homolog OS=Danio rerio OX=7955 GN=noc3l PE=2 SV=1
Q8VI84	Nucleolar complex protein 3 homolog OS=Mus musculus OX=10090 GN=Noc3l PE=2 SV=2
Q5R952	Nucleolar complex protein 3 homolog OS=Pongo abelii OX=9601 GN=NOC3L PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003711 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03914 all species →	CBF	CBF/Mak21 family	Repeat	Interproscan
PF07540 all species →	NOC3p	Nucleolar complex-associated protein	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR016903 all species →	Family	Nucleolar complex-associated protein 3	Interproscan
IPR005612 all species →	Domain	CCAAT-binding factor	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR011501 all species →	Domain	Nucleolar complex-associated protein 3, N-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14428 all species →	NUCLEOLAR COMPLEX PROTEIN 3	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003682 all species →	Molecular Function	chromatin binding	Interproscan
GO:0005730 all species →	Cellular Component	nucleolus	Interproscan
GO:0006270 all species →	Biological Process	DNA replication initiation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K14834	NOC3; nucleolar complex protein 3	-	Ribosome biogenesis	ko03009	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_038798-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

10.4Max TPM

4.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	3.86	7.02
polyp at pH7 6	18	18	5.27	10.43
coral polyp · control treatment	16	16	5.34	9.89
coral polyp · oil and dispersant treatment	16	16	3.95	6.42
coral polyp · oil treatment	16	16	4.10	8.77
coral polyp · dispersant treatment	16	16	4.16	8.90
Polyp	10	10	3.69	7.41

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.02
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.45
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.35
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.07
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.88
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.47
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.30
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.17
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.00
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.95
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.52
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.49
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.83
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.83
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.31
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.25
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.08
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.47
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.43
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.70
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.61
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.81
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.54
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.34
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.07
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.22
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.10
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.54
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.38
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.13
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.07
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.43
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.35
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.96
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.27
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.86
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.89
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.73
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.90
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.15
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.36
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.26
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.82
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.68
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.57
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.55
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.13
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.23
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.20
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.12
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.88
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.01
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.42
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.96
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.67
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.65
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.08
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.57
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.09
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.67
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.55
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.24
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.21
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.97
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.88
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.13
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.10
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.03
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.77
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.59
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.84
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.48
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.78
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.96
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.74
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.67
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.08
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.80
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.74
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.61
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.38
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.35
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.16
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.69
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.90
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.27
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.45
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.18
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.98
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.82
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.58
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.49
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.33
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.74
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.31
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.03
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.47
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.11
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.85
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.07
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	7.41
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	5.18
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	4.87
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.82
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.82
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.37
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.53
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.37
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.10
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.48

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.