Gene detail

Detailed information of OS493_039232-T1 in Lophelia pertusa

Genomic Location: scaffold_1003:1160...12709
NR annotation: KAJ7388204.1, DNA ligase 3 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_039232-T1

ATGGCGGATGGTGGTGGAGACGAAAAGCCATTTTTGGTGGAGTATGCCTCGCAGGGACGAGCCAAGTGTAAAACATGCAAGCTTCAGATAGAAAAGACTTCAACTCGAATAGGAAAATTGGTTTCGAATCCGTTCAGTGAAGATGGTGGGATGATGAAACACTGGCTACCAAGTCTACCAAAAGCTCTCCTTCACCCAAAAAGAAAGTTGTCCCAGGCCACTCTTGCCTTTGGTAAACCAAAGCCCTCCACTCCAACAAAGTCAACTGCCACAGACAATAAAAAAGCTGGAAGTTCTGGTGATGGCAGCCACAGCTCCTCACCAGTCAAGGGTGGTAGTGACAAGAATAGTAAGGATAATGCATTCCGAGAATTCAGAAGAATCTGCGCAAGACTTGCTGAAGAACCAAGCTACAATGCCAAGAGCAAAATTTTGGCTGATTTCTTCGATAAGGGGAGTTCTGGAGATGGATTTGCAGGGGACTTGACATTGTGGGTGAAAATGTTACTTCCAGGAGTAAACAAAAGAGTGTACAACTTGCAAAGTAAACAGCTCATTAAACTCTTCAGCCAGATATTTGGCTGTAGTCAAGATGACATGATGACAGACTTAGAACAGGGTGATGTATCAGAGACAGTGAGCACATTTCATGAGAACAGTCCTTTGCTGAAACCTATGAAGAAAAGTTTACTTTCTTTACGAGATGTTGATGTATTTCTTGATAAACTCAAGACGGTGACCAAGGAGGAGGATCAACAAAGAGAACTCACTAAGATGACAAGGAGTTTGGATGCACTTGATCCCAATGCCTATGAGGCATTTCAAGCGTCTAACAACCTCAGTGATGTCGTACAACGATGCCTGGAGAAGAAAGGAACCAAAACATCAAGTGCTTTACCAGGAATGAGTAAAAAGCTGAGCATCAGAGCTTCCTTAATGACACCTGTCAAACCAATGCTGGCAGAAGCTTGTAAAAGTTTTTCACATGCAGTGAAGAAATGTCCCAGTGGAATGTATGCAGAGATAAAATATGACGGAGAGAGAGTTCAGGTTCACAAGAGTGGCAATGACTTTCAGTTTTTTAGCCGCAGCCTCAAACCTGTCATTACACATAAGGTTGCTCCTATTAAAGATCATCTTCCAAAAGCCTGCCCCCATGGAAACAACTTGATTCTAGACTGCGAGGTGTTACTTGTGGATAACAACACCAGCAAACCTCTTCCATTTGGAACTCTAGGCATCCATAAGACAGAAAAAGAACTATCCAAGTTAATGTCAAGAGCAATGAAAGAAGGTCTTGAGGGACTGGTGATGAAGGATGTTAATGGTGTATATGAACCAGGAAAAAGGCACTGGCTTAAGATGAAGAAAGATTATCTTGAAGAGGGTGCCATGGCTGATACTGCTGACCCTGGTGGTACTGGGGGGCCTATTATGGCACCGGAAACAAAGTTCCCTGTACCCTTTGCAGGTGGCTTAATGTCGACCTTTCTGATGGGAGTCTGGGATCCAGCCACTAAACAGTGGTGTACTGTGGCTAAGTGCGGTAATGGCCATGACGACAAGACTATCGAGAAGCTCAACAGGGAACTCAAAATGAAGAAAATCAGCAAGAAAGCCCCCGTGTGGGAGATAACAGGGGCGGAATTCAGTAAATCCACGACACATACTGCAGATGGAATATCGATCAGATTTCCTCGTGTGACACGGATCAGAGATGACAAGGATTGGAAAACTGCAAATGACTTGCCGCATCTGAAGGTTTGTTCAAGAACTCAAGAGCTTCAACCACTAAGTGATATTGTGATGTTCACTGTAGATGTAGCAGACCTGGACGATAATGATGATGACGATGACGAGGAAGGAAATGATGATGGTGATGACGATGATGATGATGACGTCCCATCAAAGGATGAGGAGATGAAAGGTGAAACTGCTGAGGAACCGTCTGAAGCTAAAACTGAAACAAGAAAGAGAAAAGCACTAGACATTGAAGGAGAAGGATCGCCGAATAAAAAAGATGGTGTCGCATGTGGATAG

Transcript

OS493_039232-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P49916	DNA ligase 3 OS=Homo sapiens OX=9606 GN=LIG3 PE=1 SV=2
P97386	DNA ligase 3 OS=Mus musculus OX=10090 GN=Lig3 PE=1 SV=2
P16272	DNA ligase OS=Vaccinia virus (strain Western Reserve) OX=10254 GN=OPG180 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003019 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF04675 all species →	DNA_ligase_A_N	DNA ligase N terminus	Family	Interproscan
PF01068 all species →	DNA_ligase_A_M	ATP dependent DNA ligase domain	Domain	Interproscan
PF04679 all species →	DNA_ligase_A_C	ATP dependent DNA ligase C terminal region	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR050191 all species →	Family	ATP-dependent DNA ligase	Interproscan
IPR012340 all species →	Homologous_superfamily	Nucleic acid-binding, OB-fold	Interproscan
IPR016059 all species →	Conserved_site	DNA ligase, ATP-dependent, conserved site	Interproscan
IPR036957 all species →	Homologous_superfamily	Zinc finger, PARP-type superfamily	Interproscan
IPR001510 all species →	Domain	Zinc finger, PARP-type	Interproscan
IPR012310 all species →	Domain	DNA ligase, ATP-dependent, central	Interproscan
IPR036599 all species →	Homologous_superfamily	DNA ligase, ATP-dependent, N-terminal domain superfamily	Interproscan
IPR012308 all species →	Domain	DNA ligase, ATP-dependent, N-terminal	Interproscan
IPR012309 all species →	Domain	DNA ligase, ATP-dependent, C-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45674 all species →	DNA LIGASE 1/3 FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003910 all species →	Molecular Function	DNA ligase (ATP) activity	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006266 all species →	Biological Process	DNA ligation	Interproscan
GO:0006273 all species →	Biological Process	lagging strand elongation	Interproscan
GO:0006288 all species →	Biological Process	base-excision repair, DNA ligation	Interproscan
GO:0006302 all species →	Biological Process	double-strand break repair	Interproscan
GO:0070421 all species →	Cellular Component	DNA ligase III-XRCC1 complex	Interproscan
GO:0003909 all species →	Molecular Function	DNA ligase activity	Interproscan
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0008270 all species →	Molecular Function	zinc ion binding	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0006281 all species →	Biological Process	DNA repair	Interproscan
GO:0006310 all species →	Biological Process	DNA recombination	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_039232-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_039232-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

15.6Max TPM

4.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	4.44	6.84
polyp at pH7 6	18	17	4.78	8.77
coral polyp · control treatment	16	16	5.50	10.32
coral polyp · oil and dispersant treatment	16	16	4.83	15.60
coral polyp · oil treatment	16	16	4.76	7.36
coral polyp · dispersant treatment	16	16	4.25	8.26
Polyp	10	10	5.61	13.16

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.84
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.66
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.60
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.52
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.49
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.19
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.25
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.06
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.94
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.85
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.76
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.70
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.64
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.02
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.78
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.65
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.51
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.46
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.77
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.63
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.14
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.18
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.12
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.81
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.11
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.92
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.87
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.77
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.56
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.93
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.57
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.39
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.94
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.41
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.93
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.32
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.57
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.41
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.40
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.04
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.10
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.87
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.73
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.40
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.78
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.19
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.93
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.03
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.94
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.59
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.75
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.60
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.90
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.80
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.20
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.81
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.63
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.23
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.15
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.05
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.04
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.64
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.39
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.70
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.61
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.46
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.03
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.36
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.94
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.92
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.44
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.83
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.23
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.69
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.64
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.61
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.43
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.39
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.59
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.26
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.26
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.02
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.62
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.26
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.57
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.32
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.31
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.35
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.62
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.51
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.49
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.95
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.90
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.44
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.98
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.92
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.22
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.48
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.62
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	13.16
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	9.81
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	6.77
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	5.24
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.85
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	4.22
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.68
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.63
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	2.63
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.09

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.