Gene detail

Detailed information of XP_029213961.2 in Acropora millepora

Genomic Location: NC_058071.1:19730000...19732448
NR annotation: XP_029213961.2, cadmium/zinc-transporting ATPase HMA2-like [Acropora millepora]
Species Acropora millepora · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_029213961.2

ATGATGTCACCCTCAGAGCTCGTCAGTTCCTTAAACCGAGTTCACCTGGGAGCAAGCATCATGGAAAGTGGCTCCCAACAGGCCGAAAGCAAGATCAACCGTCTTCCTCCCACTCTTTTATCATTTTTTATATATCTCTTAGCGCAAACCATTATTTTTATGGTAGCTGTTATAGCGCTCTTTGCTAAGGCATCTTGGTATCGGTGGATAGCCATTGCGGAGATAATATTTGGTATTGCACCAGTTTTGAGAAAAGCGTTGATGTCTTTCAAGACCTTCTCAGTCGACATAAATGTGCTTATGCTTATTGCCATGTCAGGAACTCTGGCAATTCGACAATGGTTAGAAGGGGCAGCTGTAGTTTACGTATTCTCTCTAGCAGAAGGATTGCAGGAGCTTTGCATGCACAAAGTTCAGCAAACAATCTCTGGGTTAATGGTCGAGGCACCTCAAGAAGCGATAATGGCGATTACAGGCCAGAGTGTTCCGGTTGAACAGGTAACTATAGGAACAGCCATTGCAATCAGACCTGGTGAACTCATTCCCTTGGACGGTAAGGTAGTGAAAGGCAAAGCCGCTGTCGATGAAAGTTCTGTTTCTGGAGAATCTGTACCTGTTGAGAAAACTGTGGGCTCGAAGGTGTTTAGTGGAACTGTCAATCAAAATGGCTACTTGGAAGTTGAGACCACATCCGACTCCACTTCCTCTACAGTCGTCAAAATTGCACAGCTCGTTCAAGAAGCCAAGACTGGTTCAGCGAGCACTGAATTGTGTGTAAACCAGTTTGCCAAGTACTATACACCTGCAGTGGTCGTTAGCGCGACTCTACTATTTGCTATTCCCGCCATACTTGGTGCAACTGGTGTGGGTACGTATTCAGAAGAGATAACAGAGTGGGGCCGAAGAGCACTTGCACTTTTGGTTATAGCTTGCCCCTGCGCTTTGGTCATGTCAACCCCGATTGCAGTGGTTTGTGGTATCACTGCGGCTGCACGGAAAGGAGCTCTAATTAAACGGGGGGCTAGTCTTGAGACGCTAGCGGAATTAGAAGTTTTAGCTTTTGACAAAACGGGAACTCTGACTGAAGGGAAGTTTCAAGTTGTTGGCATGGAATGTTCGTTTGGTGTGCAAGAACAAATTGTCCTGCGTTTAGCTGCGGCGCTTGAAAGCAAGTCTAGTCACCCTCTCGCAGCAGCTATAGTGAATGAGTTCACTGGTTGTGTCACGGAAATGGCCACTTCGCAAATCTTAACTTTACCAGAAGTCTCACATTTCGAGCTTCATGAAGGTCAAGGTATTTCTGGTGTTGTTGAAGGTCATTTGGTTCAGATTGGCAACCTTGAATTCCTGCATCGAATTACAAACAAAACACTAAGTAAATACATGAACGACAAGTACATAGCGTGGAGCAACGAAAGTAAGACGGTTATTTTTATTTGTGTTGACAACAAACTAGCAATTATGATTGCTTTGGCAGATATACTCAGACCCAACAGTCTGGCTACGCTTGATTGGCTGAGAAATCTTCGTGTCCAGTCAGCTATGATCACTGGTGACAATACACGGACAGCCATGGCTGTCAAAGATAAACTAGGCCTTGACGAGTGTATTGCCGAAATGAAACCACAGGACAAGCTGGCGTGGGTCAAACAAAGACAAATTGGAATAAAGGACACTGACAATGGGAACTATGACAATGATCAACCAACGGGTCATCTATTCTGCTTATCTACCTGCTGTTTACATCGTGGCTGCCATTCCTTGAGATGCCGTGAAAACAAGAAAAGTAATGTGGGAATGGTCGGGGATGGTGTTAACGATGGTCCAGCGCTAGCGTCGGCGAATGTTGGAATTGCGATGGGCGCAGGAGGTACAGCTTTGGCAGTGGAAGCTGCAGACGTCGCACTGATGAACAATAACCTTGCCAAAATACCGGAAATAGTTGAACTTGGACGTTTCTGTCGCCGCATTGTTTTTCAGAATATTGGTCTTTCGGTTATTCTTAAGCTTGCTATGGTGATAGCGGCGCTTGCTGGAAAGGCTTCACTCGTGATAGCTGTCATGGCGGATGTACTTGGTTTATTGTTCGTGCTACTAAACGGCATAAGACCTCTTTGGTGGAAGGTCACTGACAAACACAAGAACTTAGATATTCAGCGTTTGGGCTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A3BF39	Cadmium/zinc-transporting ATPase HMA2 OS=Oryza sativa subsp. japonica OX=39947 GN=HMA2 PE=1 SV=1
Q9SZW4	Cadmium/zinc-transporting ATPase HMA2 OS=Arabidopsis thaliana OX=3702 GN=HMA2 PE=2 SV=1
Q8H384	Cadmium/zinc-transporting ATPase HMA3 OS=Oryza sativa subsp. japonica OX=39947 GN=HMA3 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001634 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00122 all species →	E1-E2_ATPase	E1-E2 ATPase	Family	Interproscan
PF00702 all species →	Hydrolase	haloacid dehalogenase-like hydrolase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR023298 all species →	Homologous_superfamily	P-type ATPase, transmembrane domain superfamily	Interproscan
IPR023214 all species →	Homologous_superfamily	HAD superfamily	Interproscan
IPR001757 all species →	Family	P-type ATPase	Interproscan
IPR044492 all species →	Domain	P-type ATPase, haloacid dehalogenase domain	Interproscan
IPR051014 all species →	Family	Cation Transport ATPase Type IB	Interproscan
IPR036412 all species →	Homologous_superfamily	HAD-like superfamily	Interproscan
IPR023299 all species →	Homologous_superfamily	P-type ATPase, cytoplasmic domain N	Interproscan
IPR027256 all species →	Family	P-type ATPase, subfamily IB	Interproscan
IPR008250 all species →	Homologous_superfamily	P-type ATPase, A domain superfamily	Interproscan
IPR018303 all species →	PTM	P-type ATPase, phosphorylation site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR48085 all species →	CADMIUM/ZINC-TRANSPORTING ATPASE HMA2-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005215 all species →	Molecular Function	transporter activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan
GO:0022857 all species →	Molecular Function	transmembrane transporter activity	Interproscan
GO:0055085 all species →	Biological Process	transmembrane transport	Interproscan
GO:0000166 all species →	Molecular Function	nucleotide binding	Interproscan
GO:0006812 all species →	Biological Process	monoatomic cation transport	Interproscan
GO:0019829 all species →	Molecular Function	ATPase-coupled monoatomic cation transmembrane transporter activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01534	zntA; Zn2+/Cd2+-exporting ATPase	EC:7.2.2.12 EC:7.2.2.21	Enzymes with EC numbers	-	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_029213961.2 across 54 RNA-seq samples of Acropora millepora. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

54Samples

36TPM > 0

2Conditions

470.0Max TPM

55.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole larvae	30	15	48.84	469.95
branch	24	21	63.69	326.91

Per sample · hover a bar for the full sample record

Show the sample table (54 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR1929624	whole larvae	whole larvae	adult	not recorded	SRP056536	469.95
SRR1929634	whole larvae	whole larvae	adult	not recorded	SRP056536	154.28
SRR1929623	whole larvae	whole larvae	adult	not recorded	SRP056536	131.52
SRR1929625	whole larvae	whole larvae	adult	not recorded	SRP056536	116.94
SRR1929633	whole larvae	whole larvae	adult	not recorded	SRP056536	109.47
SRR1929628	whole larvae	whole larvae	adult	not recorded	SRP056536	103.95
SRR1929614	whole larvae	whole larvae	adult	not recorded	SRP056536	71.95
SRR1929613	whole larvae	whole larvae	adult	not recorded	SRP056536	67.94
SRR1929609	whole larvae	whole larvae	adult	not recorded	SRP056536	60.06
SRR1929617	whole larvae	whole larvae	adult	not recorded	SRP056536	51.29
SRR1929629	whole larvae	whole larvae	adult	not recorded	SRP056536	39.71
SRR1929621	whole larvae	whole larvae	adult	not recorded	SRP056536	33.20
SRR1929612	whole larvae	whole larvae	adult	not recorded	SRP056536	23.06
SRR1929605	whole larvae	whole larvae	adult	not recorded	SRP056536	19.30
SRR1929606	whole larvae	whole larvae	adult	not recorded	SRP056536	12.54
SRR1929607	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929608	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929610	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929611	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929615	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929616	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929618	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929619	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929620	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929622	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929626	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929627	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929630	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929631	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929632	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929604	branch	branch	adult	not recorded	SRP056536	326.91
SRR1929595	branch	branch	adult	not recorded	SRP056536	133.18
SRR1929581	branch	branch	adult	not recorded	SRP056536	112.62
SRR1929593	branch	branch	adult	not recorded	SRP056536	98.45
SRR1929588	branch	branch	adult	not recorded	SRP056536	88.65
SRR1929599	branch	branch	adult	not recorded	SRP056536	82.54
SRR1929589	branch	branch	adult	not recorded	SRP056536	76.43
SRR1929586	branch	branch	adult	not recorded	SRP056536	76.41
SRR1929590	branch	branch	adult	not recorded	SRP056536	73.50
SRR1929587	branch	branch	adult	not recorded	SRP056536	64.99
SRR1929597	branch	branch	adult	not recorded	SRP056536	59.76
SRR1929598	branch	branch	adult	not recorded	SRP056536	45.62
SRR1929592	branch	branch	adult	not recorded	SRP056536	43.00
SRR1929583	branch	branch	adult	not recorded	SRP056536	41.39
SRR1929585	branch	branch	adult	not recorded	SRP056536	39.48
SRR1929602	branch	branch	adult	not recorded	SRP056536	36.31
SRR1929600	branch	branch	adult	not recorded	SRP056536	35.00
SRR1929601	branch	branch	adult	not recorded	SRP056536	31.82
SRR1929582	branch	branch	adult	not recorded	SRP056536	24.29
SRR1929596	branch	branch	adult	not recorded	SRP056536	21.64
SRR1929584	branch	branch	adult	not recorded	SRP056536	16.65
SRR1929591	branch	branch	adult	not recorded	SRP056536	0.00
SRR1929594	branch	branch	adult	not recorded	SRP056536	0.00
SRR1929603	branch	branch	adult	not recorded	SRP056536	0.00

Source: CnidoSite RNA-seq expression matrices (AMILL_TPM, StringTie quantification over 54 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora millepora tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	7	XP_044165014.1	0.781292286160599
Negatively correlated	27	XP_029214438.2	-0.396894772448159

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora millepora, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

Dataset	Tissue / stage	Cells	Cell types	This gene	Marker of
AMILL_whole_adult	Whole adults · Adult tissues/organs	25,164	27	not in this dataset	–

A gene is in viewer when the dataset ships a per-cell expression vector for it; marker only means it is in the dataset’s ranked marker table but no vector was exported, so the atlas cannot draw it; not in this dataset means the dataset’s own gene-ID table does not list it, so no expression claim can be made for that dataset. unmapped is deliberately weaker still: the dataset has no gene-ID table on CnidoSite yet, so nothing is claimed in either direction. Where markers are listed, the numbers are log2 fold change and the percentage of cells of that type in which the gene was detected.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

DNA methylation (bisulphite samples)

Sample	Methylation profile
planula	open

The DNA Methylation page locates this gene by scanning the bisulphite table, which holds one row per cytosine. For the largest datasets that scan takes a while to return; it does not mean the link is broken.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →