Gene detail

Detailed information of XP_044174167.1 in Acropora millepora

Genomic Location: NC_058068.1:18274958...18278472
NR annotation: XP_044174167.1, E3 ubiquitin-protein ligase TRIM71-like [Acropora millepora]
Species Acropora millepora · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_044174167.1

ATGGATATCAAAACCTTTCTGGACAATATTTACGAACACGTATGCTGTCCCGTGTGTATGAACAAGTTCACTAATCCAAAACTGCTTCCATGTTTGCACACGTTTTGCCTTCACTGTCTGCAAAGAATTCAAGCAACCAGCGGAATTCGAGACGCTATTTTATGCCCCGAGTGTCGTCGAAACTTCACCATCCCTGGAAACGGTGATCTCAACACTTTACCGACAAACTTTCGCTTGAACAGTTTGTTGGATGCTTTGCCCGCCACAGAGTGCAAAACGAGTGGCGTCAAGTGTGAAAATTGCGAGAAAACAAGACAACAATCTGCCTACTGCTTCACTTGTTGTTCGTTCTGGTGCGATGACTGCCTTCCTTTCCATAACGGGATAAGAACCAATAAAGAACACCACGTGTTGGCTTTGAAAGATTTTCGAGATGAAGACTTTGAGAACATTCTCAAGCAGCCACCATTTTGTGCAAAACACGAGGAGAAATTAAAGTTCTTCTGTCAGCTTTGCGAAACAACAATATGTTATTCGTGTGCTGTGATAGACCACGAAGGTCACGCTAAGATTGATTTGGAAGACGCTGCAAAAGAACGCAAGTTGAGAATAGTTAGAGCCCTTGAATTCAAGAAACGAAAAGCCCAAAACAAGGTGACAAGAACTGCCAAACTTGGTGAAAGCTGTATCCAAGTTCAAGAAGAAGCCGCAAGAATAAAGAGCGACATACAGAAATTTACTAACAATCTTATTGCAGCCATTGAAGCAAAAATGAACAAGATCTTTGATGAGGTAGAAATGAAAGCAAAACAGTGCCTGGAGAATCTAGGAGAAAAAAGAAGGGAGATTCAAGGAGAAATGAAAAAGGACCAAACAGCAATCGAAAAAAGCGAGATGATTTTAAAGCGAAGCACAAGCGCTCAAATCATGCAACCAAATGATTTCCTAGACGAACTGTTTCGGGAGGAAGGTGAGCAAGAAGATACGGTTGACCTTGACGGAGAACATGTCATAGATTTTTATTTTCAAAGAAATGAAGAATTGTTTAATGACGTTTACGCTAGACAACTGGGATTTTTGAAAAGAAAAACTAGCCCGAAAGAGTCGACGGTTGAGGGAAAAGGAATCAGCGAAGGAACTGTTGGACTTAAAGCCGAGATTGTTGTCAAAACACGAGACATTCTGAGAGAACAAGTCTACGATAAAAATAACCGGATAACAATGGAAATCAGGAATCATGAAGGAAATGACTGTTCAACCAAACCGCAAATCCACGACAACAAAGATGGCAGCTATGCGATCAGCTACTTTGCCAAAGAAAGCGGAACATGTCAAGCATCCGTGAAAGTTAATGGACAACATGTGCGTGGCAGTCCCTTTAAAACTGAATTCAAACCCAGACTGTTCAAACTCGTGTCATCCTTTGGAAAACGTGGATCAGCTGATGGAATGTTTAGTAGACCTTGGGGGATAGCAGTGAATGAAAAAGACGAGATTGCAGTGACTGATCGTTGTAACCATCGCATACAAATATTTAAAAGTGATGGTACTCACTTAAGATCGTTTGGTAGACTAGGTAATCAGCAGGGACAGTTCAACAGGTCTTCTGGGATAGCTTTCTTTAATAATAACATTATAGTGTCAGACACTGGTAACTATCGAGTTCAAATCTTTGATGATCAGGGACACTATCTTGATCAGTTTGGAGAAAAGGGAAAACTGAATCACCAGCTTGAGAATCCTGTTGGGCTGTCAATTGACAGGGATGGCAACATCATTGTCGCTGATTATGGTAACAAGTCAATCAAGATCTTTAAGCTTGACGGCCGGTTTTTGCGTAGAGTCGGCGAAGAAGGTTCTTTCAGCGCTCTCTGTCACTGCATACAACACGACAACTATTTTATTGGATCAGACACTGGAGACCATTGTATAAAAGTTTTTGATGAACAGGGCAAGTTTCTTTATCAATTCGGGAGGAGGGGGACTGGGGATGGGGACTTTTACCGGCCTGGCTGCCTGTCTGTGGACAGAGTAGGACATCTGTTGGTTTGTGATTCAATGAATCACCGAGTCCAGGTGTTTAAACTCAACGGAGAGTTTGTAACAAAGTTTGGAGCATCTGGTAAAGAAGAGGGAAAGTTCAATCGCCTGCCAATCTCCACAGCAATCCTTAGCGATGGTAGAGTAATTGTCACTGATCTTAACAACCATCGAGTTCAGGTTTTTGAGTAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5BIM1	E3 ubiquitin-protein ligase TRIM45 OS=Bos taurus OX=9913 GN=TRIM45 PE=2 SV=1
Q9ESN6	Tripartite motif-containing protein 2 OS=Mus musculus OX=10090 GN=Trim2 PE=1 SV=1
D3ZQG6	Tripartite motif-containing protein 2 OS=Rattus norvegicus OX=10116 GN=Trim2 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000211 (this species only) · gene tree & orthology
Ubiquitin family	E3\|E3 activity RING\|RING · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00630 all species →	Filamin	Filamin/ABP280 repeat	Domain	Interproscan
PF17170 all species →	DUF5128	6-bladed beta-propeller	Repeat	Interproscan
PF13445 all species →	zf-RING_UBOX	RING-type zinc-finger	Domain	Interproscan
PF01436 all species →	NHL	NHL repeat	Repeat	Interproscan
PF00643 all species →	zf-B_box	B-box zinc finger	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001258 all species →	Repeat	NHL repeat	Interproscan
IPR047153 all species →	Family	TRIM45/56/19	Interproscan
IPR013083 all species →	Homologous_superfamily	Zinc finger, RING/FYVE/PHD-type	Interproscan
IPR017907 all species →	Conserved_site	Zinc finger, RING-type, conserved site	Interproscan
IPR001841 all species →	Domain	Zinc finger, RING-type	Interproscan
IPR014756 all species →	Homologous_superfamily	Immunoglobulin E-set	Interproscan
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan
IPR001298 all species →	Repeat	Filamin/ABP280 repeat	Interproscan
IPR017868 all species →	Repeat	Filamin/ABP280 repeat-like	Interproscan
IPR011042 all species →	Homologous_superfamily	Six-bladed beta-propeller, TolB-like	Interproscan
IPR027370 all species →	Domain	Zinc finger, RING-type, eukaryotic	Interproscan
IPR000315 all species →	Domain	B-box-type zinc finger	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR25462 all species →	BONUS, ISOFORM C-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0008270 all species →	Molecular Function	zinc ion binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_044174167.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_044174167.1 across 54 RNA-seq samples of Acropora millepora. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

54Samples

3TPM > 0

2Conditions

9.6Max TPM

0.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole larvae	30	1	0.19	5.58
branch	24	2	0.55	9.61

Per sample · hover a bar for the full sample record

Show the sample table (54 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR1929626	whole larvae	whole larvae	adult	not recorded	SRP056536	5.58
SRR1929605	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929606	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929607	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929608	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929609	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929610	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929611	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929612	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929613	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929614	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929615	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929616	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929617	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929618	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929619	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929620	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929621	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929622	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929623	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929624	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929625	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929627	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929628	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929629	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929630	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929631	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929632	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929633	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929634	whole larvae	whole larvae	adult	not recorded	SRP056536	0.00
SRR1929583	branch	branch	adult	not recorded	SRP056536	9.61
SRR1929598	branch	branch	adult	not recorded	SRP056536	3.54
SRR1929581	branch	branch	adult	not recorded	SRP056536	0.00
SRR1929582	branch	branch	adult	not recorded	SRP056536	0.00
SRR1929584	branch	branch	adult	not recorded	SRP056536	0.00
SRR1929585	branch	branch	adult	not recorded	SRP056536	0.00
SRR1929586	branch	branch	adult	not recorded	SRP056536	0.00
SRR1929587	branch	branch	adult	not recorded	SRP056536	0.00
SRR1929588	branch	branch	adult	not recorded	SRP056536	0.00
SRR1929589	branch	branch	adult	not recorded	SRP056536	0.00
SRR1929590	branch	branch	adult	not recorded	SRP056536	0.00
SRR1929591	branch	branch	adult	not recorded	SRP056536	0.00
SRR1929592	branch	branch	adult	not recorded	SRP056536	0.00
SRR1929593	branch	branch	adult	not recorded	SRP056536	0.00
SRR1929594	branch	branch	adult	not recorded	SRP056536	0.00
SRR1929595	branch	branch	adult	not recorded	SRP056536	0.00
SRR1929596	branch	branch	adult	not recorded	SRP056536	0.00
SRR1929597	branch	branch	adult	not recorded	SRP056536	0.00
SRR1929599	branch	branch	adult	not recorded	SRP056536	0.00
SRR1929600	branch	branch	adult	not recorded	SRP056536	0.00
SRR1929601	branch	branch	adult	not recorded	SRP056536	0.00
SRR1929602	branch	branch	adult	not recorded	SRP056536	0.00
SRR1929603	branch	branch	adult	not recorded	SRP056536	0.00
SRR1929604	branch	branch	adult	not recorded	SRP056536	0.00

Source: CnidoSite RNA-seq expression matrices (AMILL_TPM, StringTie quantification over 54 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora millepora tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	18	XP_044183011.1	0.821732515966011
Negatively correlated	3	XP_044171097.1	-0.291875416641667

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora millepora, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

Dataset	Tissue / stage	Cells	Cell types	This gene	Marker of
AMILL_whole_adult	Whole adults · Adult tissues/organs	25,164	27	not in this dataset	–

A gene is in viewer when the dataset ships a per-cell expression vector for it; marker only means it is in the dataset’s ranked marker table but no vector was exported, so the atlas cannot draw it; not in this dataset means the dataset’s own gene-ID table does not list it, so no expression claim can be made for that dataset. unmapped is deliberately weaker still: the dataset has no gene-ID table on CnidoSite yet, so nothing is claimed in either direction. Where markers are listed, the numbers are log2 fold change and the percentage of cells of that type in which the gene was detected.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

DNA methylation (bisulphite samples)

Sample	Methylation profile
planula	open

The DNA Methylation page locates this gene by scanning the bisulphite table, which holds one row per cytosine. For the largest datasets that scan takes a while to return; it does not mean the link is broken.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →