Gene detail

Detailed information of evm.model.Ap1.2949 in Astrangia poculata

Genomic Location: Ap1:30289522...30309880
NR annotation: CAH3037661.1, unnamed protein product [Pocillopora meandrina]
Species Astrangia poculata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

evm.model.Ap1.2949

atggccgccgaatcactgaacgatgaattagatttaaagaaggaaaaacgtttgtttttctctgttctacaggaaaatagtcccactcttgctacagtagtaaaagttgttccaacagcaaataatggctcaccagagctgctcaaccttcatcatgagcaggataaagagacacaaaaagaggtcatttggttcaactttcaaaagacaaagtatgtctatgacagtgaagaaaaaaaacaattctgccaggtggcttttcccatcaatgaaaccatagaacattacaacagctgtaaaggatatcaagaagaagctgatgttgaaagagctaagaaaatatatggatcaaatgagcttcagatggatgtgcctgagtttggtgaattgtttaaagagagggccactgcacctttctttgtgttccaggtgttttgtgttggcttgtggtgtcttgatgagtactggtactacagtgtctttactcttttcatgttggtcgcttttgaagccactcttgtacagcagcaattgaagaacatgaaggaaataaggaatatgggaagcaaaccttacttgatacaggtctacaggcatagaaaatggagacctatattgagctctgaacttcttccaggagatatttgttctattggaagacctaaaaattctgatgtactgattccatgtgatatggtgttactgagaggctcctgcattgtggatgaggccatgttgactggagaatctgtgccgcaaatgaaggagccaattgaggatttgccagatgatgaagtgtttgacttggagcaacacagtaaattacatgtgttatcaggagggacaaaagttgttcaacattctcctcctctcaagacttcttctgggttgaaagctcctgataatggaagtgtagcttatgtcttaaggactggattcaatacctcacagggaaagctgttgaggacaattttatttggtgtaaagcgggtcacagccaacaatctggagacttttctcttcatcctgtttttgctgatatttgctgtttctgcggcagcatatgtttggattaaaggcactgaggatcccaagagaaatcgttacaaactattcttggagtgcacccttattttgacatcagtggttccaccagagcttcctattgaactgtccctggctgtgaattcctcgctgatggctctacagaaactgggtgtgtactgcacggagccttttagaattccatttgctggtaaagttgatgtatgctgctttgacaaaacaggaacattaacaagtgataaccttatagtacaaggtgttgcaggtctcaaagatgatgatgaagtttgtgctgtatgcgatgttcctgatgaaacagcacatgtgctagcttcatgtcactcgctggctttccttgatgacagtttagtgggtgaccctcttgaaaaagcggtcttacaagcagtggactggagacttacgagaggagatatcgtcatgccaaacaaaggccggcgtgtttccatgcgtatagtgcatcgtcaccatttctccagcgctctaaagagaatgtcagctattgtgtctttacaaaatcccgggtcatcatccagtgagtatatcgtgacagtaaaaggagctcctgaaacgctaagatcgatgtacaaaaccgttcccaaaaactatgacgctatctaccacaggatgacttgccaaggagctagagttttggcgctgggtttcaagaagattggagaagtggcggctaaagagatccgtgacttgaagcgtgaagagtgtgaatgtgatctacagtttgcgggattcgttgtaatagcgtgtccactgaagagcgactctaaagcagccatcaaacagatccaggaatcatcacatcatctgaccatgattactggggataacccgctgactgcatgtcacgtggctcgcgagcttcggctcaccagacgtgaaattgtggttttgacacctcctgaaagcaccaatgatcatgtagaaagtgagtggcactggcagccagtggatcactccttcagtcttcccatcattccctctggcggcatcaaagagctgacttccaaatttgacttgtgtgtcacaggagaggcattttcctacttacagtcgactgagaaattagcaaagttcttccactctatagttcaaaacgtgcaagtgttcgcacgagtggctcctaaacaaaaggaattggttataaccaaactcaagagcaaaggttttgtgacgttaatgtgcggtgacgggactaatgacgtaggagcactcaagcatgcgcactgtggtgtggccttgcttgctggtgctccagagaaacttcctgaacacggcaagaaaagtgctccgaaatccaaagaagataaaccctcttcatcgcatcaatcagaagaaaaaagtaaaaacgattcaattaagatcgtttcaagaggacatctcccccctgcacctgccaaaggagcttcacgagcagctaagatgcgtgctgtggctaggggggacgacactgcctccaccttgaaacacgaacagcagaaaaagatccaggagatgttgaaacaaatagacgaaatagatcaacctcaagttgttcggttgggtgatgcgtcaatagcgtcgcctttcacctccaagcaatcctctgtcatggctgtttgccacatcgtaaagcagggtcgctgtacactggtcaccactctgcagatgttcaagattcttgcgttaaacgcgctcatactcgcttacagtcaaagtgtgttgtatttagatggaatcaagttcagtgacggacaagctacattacaaggcgttttattggctggctgcttcttgtttatttctcgttctaagcctcttccgactctctccaagcgccgtccattgccaaatatattcaacattttcactatagtaacagtactgtctcagtttgctgttcacttctgggccctcgttttcatggtacaacaagcaaaacgactcacccctagcatggaatctaaacatgtagacttggacgccaagtttcagcccaccattttgaacagtactgtgtatattgtctccatcgctatgcaactggctacttttgctatcaactacaagggtcacccgttcatggagagcctgcttgacaacaaggccttgctgtacagtctaatggcgtctggtggattcgtcctgtgcatgattactggttctgttcctgaaattaatcagcagtttgaaattgtaccctttcctccaaagttccgcgaaacattcatgcaagtccttctggcggactttgtggtggtctttgtcctggacagaatattagactttttgcttggcagtgctaagctgcgacagcattga

Transcript

evm.model.Ap1.2949

ATGGCCGCCGAATCACTGAACGATGAATTAGATTTAAAGAAGGAAAAACGTTTGTTTTTCTCTGTTCTACAGGAAAATAGTCCCACTCTTGCTACAGTAGTAAAAGTTGTTCCAACAGCAAATAATGGCTCACCAGAGCTGCTCAACCTTCATCATGAGCAGGATAAAGAGACACAAAAAGAGGTCATTTGGTTCAACTTTCAAAAGACAAAGTATGTCTATGACAGTGAAGAAAAAAAACAATTCTGCCAGGTGGCTTTTCCCATCAATGAAACCATAGAACATTACAACAGCTGTAAAGGATATCAAGAAGAAGCTGATGTTGAAAGAGCTAAGAAAATATATGGATCAAATGAGCTTCAGATGGATGTGCCTGAGTTTGGTGAATTGTTTAAAGAGAGGGCCACTGCACCTTTCTTTGTGTTCCAGGTGTTTTGTGTTGGCTTGTGGTGTCTTGATGAGTACTGGTACTACAGTGTCTTTACTCTTTTCATGTTGGTCGCTTTTGAAGCCACTCTTGTACAGCAGCAATTGAAGAACATGAAGGAAATAAGGAATATGGGAAGCAAACCTTACTTGATACAGGTCTACAGGCATAGAAAATGGAGACCTATATTGAGCTCTGAACTTCTTCCAGGAGATATTTGTTCTATTGGAAGACCTAAAAATTCTGATGTACTGATTCCATGTGATATGGTGTTACTGAGAGGCTCCTGCATTGTGGATGAGGCCATGTTGACTGGAGAATCTGTGCCGCAAATGAAGGAGCCAATTGAGGATTTGCCAGATGATGAAGTGTTTGACTTGGAGCAACACAGTAAATTACATGTGTTATCAGGAGGGACAAAAGTTGTTCAACATTCTCCTCCTCTCAAGACTTCTTCTGGGTTGAAAGCTCCTGATAATGGAAGTGTAGCTTATGTCTTAAGGACTGGATTCAATACCTCACAGGGAAAGCTGTTGAGGACAATTTTATTTGGTGTAAAGCGGGTCACAGCCAACAATCTGGAGACTTTTCTCTTCATCCTGTTTTTGCTGATATTTGCTGTTTCTGCGGCAGCATATGTTTGGATTAAAGGCACTGAGGATCCCAAGAGAAATCGTTACAAACTATTCTTGGAGTGCACCCTTATTTTGACATCAGTGGTTCCACCAGAGCTTCCTATTGAACTGTCCCTGGCTGTGAATTCCTCGCTGATGGCTCTACAGAAACTGGGTGTGTACTGCACGGAGCCTTTTAGAATTCCATTTGCTGGTAAAGTTGATGTATGCTGCTTTGACAAAACAGGAACATTAACAAGTGATAACCTTATAGTACAAGGTGTTGCAGGTCTCAAAGATGATGATGAAGTTTGTGCTGTATGCGATGTTCCTGATGAAACAGCACATGTGCTAGCTTCATGTCACTCGCTGGCTTTCCTTGATGACAGTTTAGTGGGTGACCCTCTTGAAAAAGCGGTCTTACAAGCAGTGGACTGGAGACTTACGAGAGGAGATATCGTCATGCCAAACAAAGGCCGGCGTGTTTCCATGCGTATAGTGCATCGTCACCATTTCTCCAGCGCTCTAAAGAGAATGTCAGCTATTGTGTCTTTACAAAATCCCGGGTCATCATCCAGTGAGTATATCGTGACAGTAAAAGGAGCTCCTGAAACGCTAAGATCGATGTACAAAACCGTTCCCAAAAACTATGACGCTATCTACCACAGGATGACTTGCCAAGGAGCTAGAGTTTTGGCGCTGGGTTTCAAGAAGATTGGAGAAGTGGCGGCTAAAGAGATCCGTGACTTGAAGCGTGAAGAGTGTGAATGTGATCTACAGTTTGCGGGATTCGTTGTAATAGCGTGTCCACTGAAGAGCGACTCTAAAGCAGCCATCAAACAGATCCAGGAATCATCACATCATCTGACCATGATTACTGGGGATAACCCGCTGACTGCATGTCACGTGGCTCGCGAGCTTCGGCTCACCAGACGTGAAATTGTGGTTTTGACACCTCCTGAAAGCACCAATGATCATGTAGAAAGTGAGTGGCACTGGCAGCCAGTGGATCACTCCTTCAGTCTTCCCATCATTCCCTCTGGCGGCATCAAAGAGCTGACTTCCAAATTTGACTTGTGTGTCACAGGAGAGGCATTTTCCTACTTACAGTCGACTGAGAAATTAGCAAAGTTCTTCCACTCTATAGTTCAAAACGTGCAAGTGTTCGCACGAGTGGCTCCTAAACAAAAGGAATTGGTTATAACCAAACTCAAGAGCAAAGGTTTTGTGACGTTAATGTGCGGTGACGGGACTAATGACGTAGGAGCACTCAAGCATGCGCACTGTGGTGTGGCCTTGCTTGCTGGTGCTCCAGAGAAACTTCCTGAACACGGCAAGAAAAGTGCTCCGAAATCCAAAGAAGATAAACCCTCTTCATCGCATCAATCAGAAGAAAAAAGTAAAAACGATTCAATTAAGATCGTTTCAAGAGGACATCTCCCCCCTGCACCTGCCAAAGGAGCTTCACGAGCAGCTAAGATGCGTGCTGTGGCTAGGGGGGACGACACTGCCTCCACCTTGAAACACGAACAGCAGAAAAAGATCCAGGAGATGTTGAAACAAATAGACGAAATAGATCAACCTCAAGTTGTTCGGTTGGGTGATGCGTCAATAGCGTCGCCTTTCACCTCCAAGCAATCCTCTGTCATGGCTGTTTGCCACATCGTAAAGCAGGGTCGCTGTACACTGGTCACCACTCTGCAGATGTTCAAGATTCTTGCGTTAAACGCGCTCATACTCGCTTACAGTCAAAGTGTGTTGTATTTAGATGGAATCAAGTTCAGTGACGGACAAGCTACATTACAAGGCGTTTTATTGGCTGGCTGCTTCTTGTTTATTTCTCGTTCTAAGCCTCTTCCGACTCTCTCCAAGCGCCGTCCATTGCCAAATATATTCAACATTTTCACTATAGTAACAGTACTGTCTCAGTTTGCTGTTCACTTCTGGGCCCTCGTTTTCATGGTACAACAAGCAAAACGACTCACCCCTAGCATGGAATCTAAACATGTAGACTTGGACGCCAAGTTTCAGCCCACCATTTTGAACAGTACTGTGTATATTGTCTCCATCGCTATGCAACTGGCTACTTTTGCTATCAACTACAAGGGTCACCCGTTCATGGAGAGCCTGCTTGACAACAAGGCCTTGCTGTACAGTCTAATGGCGTCTGGTGGATTCGTCCTGTGCATGATTACTGGTTCTGTTCCTGAAATTAATCAGCAGTTTGAAATTGTACCCTTTCCTCCAAAGTTCCGCGAAACATTCATGCAAGTCCTTCTGGCGGACTTTGTGGTGGTCTTTGTCCTGGACAGAATATTAGACTTTTTGCTTGGCAGTGCTAAGCTGCGACAGCATTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9HD20	Endoplasmic reticulum transmembrane helix translocase OS=Homo sapiens OX=9606 GN=ATP13A1 PE=1 SV=2
Q9EPE9	Endoplasmic reticulum transmembrane helix translocase OS=Mus musculus OX=10090 GN=Atp13a1 PE=1 SV=2
P90747	Probable manganese-transporting ATPase catp-8 OS=Caenorhabditis elegans OX=6239 GN=catp-8 PE=3 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003290 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13246 all species →	Cation_ATPase	Cation transport ATPase (P-type)	Family	Interproscan
PF00122 all species →	E1-E2_ATPase	E1-E2 ATPase	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR023299 all species →	Homologous_superfamily	P-type ATPase, cytoplasmic domain N	Interproscan
IPR047820 all species →	Family	P5A-type ATPase	Interproscan
IPR023214 all species →	Homologous_superfamily	HAD superfamily	Interproscan
IPR036412 all species →	Homologous_superfamily	HAD-like superfamily	Interproscan
IPR006544 all species →	Family	P-type ATPase, subfamily V	Interproscan
IPR001757 all species →	Family	P-type ATPase	Interproscan
IPR044492 all species →	Domain	P-type ATPase, haloacid dehalogenase domain	Interproscan
IPR008250 all species →	Homologous_superfamily	P-type ATPase, A domain superfamily	Interproscan
IPR023298 all species →	Homologous_superfamily	P-type ATPase, transmembrane domain superfamily	Interproscan
IPR018303 all species →	PTM	P-type ATPase, phosphorylation site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45630 all species →	CATION-TRANSPORTING ATPASE-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000166 all species →	Molecular Function	nucleotide binding	Interproscan
GO:0006874 all species →	Biological Process	intracellular calcium ion homeostasis	Interproscan
GO:0015662 all species →	Molecular Function	P-type ion transporter activity	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0019829 all species →	Molecular Function	ATPase-coupled monoatomic cation transmembrane transporter activity	Interproscan
GO:0030176 all species →	Cellular Component	obsolete integral component of endoplasmic reticulum membrane	Interproscan
GO:0055085 all species →	Biological Process	transmembrane transport	Interproscan
GO:0140358 all species →	Molecular Function	P-type transmembrane transporter activity	Interproscan
GO:0005215 all species →	Molecular Function	transporter activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K14950	ATP13A1, SPF1; manganese-transporting P-type ATPase	EC:7.2.2.-	Transporters	ko02000	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of evm.model.Ap1.2949 across 49 RNA-seq samples of Astrangia poculata. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

49Samples

0TPM > 0

4Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole organism · cold control	14	0	0.00	0.00
whole organism · heat control	12	0	0.00	0.00
whole organism · cold challenge	12	0	0.00	0.00
whole organism · heat challenge	11	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR10674714	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674715	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674724	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674733	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674734	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674735	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674736	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674737	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674739	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674743	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674746	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674747	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674748	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674750	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674706	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674707	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674708	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674717	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674718	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674720	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674721	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674725	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674731	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674741	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674752	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674753	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674711	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674712	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674713	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674722	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674723	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674730	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674732	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674738	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674740	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674744	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674745	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674749	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674709	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674710	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674716	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674719	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674726	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674727	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674728	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674729	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674742	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674751	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674754	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293

Source: CnidoSite RNA-seq expression matrices (APOCU_TPM, StringTie quantification over 49 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.