Gene detail

Detailed information of evm.model.Ap1.3024 in Astrangia poculata

Genomic Location: Ap1:31027333...31041629
NR annotation: XP_027056288.1, dual specificity protein kinase TTK-like [Pocillopora damicornis]
Species Astrangia poculata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

evm.model.Ap1.3024

atggatcctgagaccacagcaatacaaaaaattcaaagtaaaggcaacagaccagaggactggctggaatttctggctttacagcgatcaagagctgcggcaggtcttactgatgaaacctgtcggcatctgctatatctttatgaaagagctgtaagtcaaattccagctgaagaaaataagcgaaatttctcctatgcccgtcttcttgtggaatttgcccaacttcaaatgaggatatcagaagatgatgcaaggagcacattccagttggcaagaagcaatgccaaacattttgctattgtttttgttgcatgggctcagtttgagctttcaacaggaaacaaaagcaaatgtcgaggcctgctgcgtaaaggaaaggattttggagcacaacccatggaattgctgataaaagcttatgacaactttgtggcaggaaagaaggtgttgattgaagactgtgaagagctgactgattttacgagttacagagggaagcaaaagagtagtgaatcgtcagtggatttgtcgcctttgagtacaggtgatgacagttcaacaggcactggcactctattcactgacagtggcacatcaaaagttgccgacaacacaagtgctgtaatttcattcaagctacccagcgtcttggagagctgtggtaaaaagcaggtgagttgcagaagaagcaacagcagcagcagtagtgatgaggcggacaccattcccttccagacatctgccaacagtcacagacacgggggcagcatgtctacacagaaaccgtctgtgaaatctacaccagacgtcaaatcaggtacagacagtcttgctgcttgtatgaatctgtcggttcggcgaaacaaagcaagacgtaccccgggagggggagggatagcttttggcctgccaatgagagtaaagatgacgctaccagcgacgctaccatcagtgagtgaacctggtgacgagctagatggtattacggaactggaatccaccgtggacgagtctcgccagagttgtgaacttgaggtggcttccacaagccaacgaagaagcagtgtacgcactgcgtcgtccagctcagaaacagaacgtgatggtgaacagagaccccctactcttgaggttcgcagggaagcattcgctcatagacaagaaaagagttcagagaatgctgcagtggaatcagagagtgtttttgcatcacaaacgacagatagccaagtatgtaatcaacagcgaaatagtagtatgcaagaagggtcgcagtcgtttactacaaatccttgctcagcaacgataaataacatcagcagacagcaaggagacggtgctaattcaagccgtcagcaaacgcttcatcaaatggcaacaccgcaccatcaaataccaacaccgcaagaacaaacgcccttgtccaacagtatcagtggatcgtgcacaattcggcgacaaagttcaagctcgatcacaccagttgtccatgcaaatggctccttttcgcaacagaatattttacaagtcagtcacagtggtcacatacaagcgatcccgggtcagtttcatggtgctggatatgccccagggtaccccccagacatgcagtttgcaagacccgcagtcgtccctgcccaggcgcctcaggaaactattgtggtgaagggcaaaacgtaccagaagttgggaactatcggcaagggagggtccagcaaggtattccaagcatttgatggaaaaagaatatgcgccataaagtacgtaaatttagaagaagcagatgactttatcgttcaaagttacatcaacgaagttcaattgctggagagactgcagggaaatgataacattgtcaaactgtttgactgggaactaagccaagagaagagccacttaattttagttatggaatgcggaagtatcgacctggcgggtttcttgagaaaaaatcgtacaaaaataacagagggtgagcttcaggtgttctggaggcaaatgctggaagctgttcacgtgattcatgaggcgcgcatcattcacagcgacctgaaacctgctaacttcctgttggtggaaggacgattaaaacttatcgatttcggaatcgctaatgctttacaaggagacaagacaagtatagagcttaacacacaggttggcacgttaaacttcatgtccccagaagcatttcaagacatctctcacgcgccgcgattcgacaatgcaggaaatgcaaaaccaagaatgaagatcggccgtgccagcgatgtgtggtccctaggctgtatcctgtacatgatggtttatggcaagacgcctttccaacatatcaccaatcacgttgttaagttacaatgcattatggatccttcacacgtcatcgagttcccggatatcaaagacaagcgcctgcttgacgtcatgaagggctgtcttcgccggtctcctaaggagcgctacagtattccacatctgttagctcacccttacattgatccgtcggcacacgatcccctggtagagattgaggacgaggataaaatgtttgacgtcctgatggagtttgcaaaagcggacgttaactcgccacgatcagttagagctcttagcaagagtttctataaacagcttctcactagtaaaaaggtcagcatctcatctgctgtacccagaccccctggtcctgttcattcccagcatgcaatgccacctcgccagcctcctccaggccctgctgtccgtcagccattggttggaattgacttacaagcgttaaatcaggcacagaaggcattaaaacctccccacgcgtcaggaaatgcgaagtacatgagagggaatgctaacgaacagaataaggaaaacgcggatcttaatgggttacttaagcacgagcttgttgaaaaatacaagaatgcacttcctcacgacacgtccgagtccacatttgaacaaacctggaacacaacatatgggaagtga

Transcript

evm.model.Ap1.3024

ATGGATCCTGAGACCACAGCAATACAAAAAATTCAAAGTAAAGGCAACAGACCAGAGGACTGGCTGGAATTTCTGGCTTTACAGCGATCAAGAGCTGCGGCAGGTCTTACTGATGAAACCTGTCGGCATCTGCTATATCTTTATGAAAGAGCTGTAAGTCAAATTCCAGCTGAAGAAAATAAGCGAAATTTCTCCTATGCCCGTCTTCTTGTGGAATTTGCCCAACTTCAAATGAGGATATCAGAAGATGATGCAAGGAGCACATTCCAGTTGGCAAGAAGCAATGCCAAACATTTTGCTATTGTTTTTGTTGCATGGGCTCAGTTTGAGCTTTCAACAGGAAACAAAAGCAAATGTCGAGGCCTGCTGCGTAAAGGAAAGGATTTTGGAGCACAACCCATGGAATTGCTGATAAAAGCTTATGACAACTTTGTGGCAGGAAAGAAGGTGTTGATTGAAGACTGTGAAGAGCTGACTGATTTTACGAGTTACAGAGGGAAGCAAAAGAGTAGTGAATCGTCAGTGGATTTGTCGCCTTTGAGTACAGGTGATGACAGTTCAACAGGCACTGGCACTCTATTCACTGACAGTGGCACATCAAAAGTTGCCGACAACACAAGTGCTGTAATTTCATTCAAGCTACCCAGCGTCTTGGAGAGCTGTGGTAAAAAGCAGGTGAGTTGCAGAAGAAGCAACAGCAGCAGCAGTAGTGATGAGGCGGACACCATTCCCTTCCAGACATCTGCCAACAGTCACAGACACGGGGGCAGCATGTCTACACAGAAACCGTCTGTGAAATCTACACCAGACGTCAAATCAGGTACAGACAGTCTTGCTGCTTGTATGAATCTGTCGGTTCGGCGAAACAAAGCAAGACGTACCCCGGGAGGGGGAGGGATAGCTTTTGGCCTGCCAATGAGAGTAAAGATGACGCTACCAGCGACGCTACCATCAGTGAGTGAACCTGGTGACGAGCTAGATGGTATTACGGAACTGGAATCCACCGTGGACGAGTCTCGCCAGAGTTGTGAACTTGAGGTGGCTTCCACAAGCCAACGAAGAAGCAGTGTACGCACTGCGTCGTCCAGCTCAGAAACAGAACGTGATGGTGAACAGAGACCCCCTACTCTTGAGGTTCGCAGGGAAGCATTCGCTCATAGACAAGAAAAGAGTTCAGAGAATGCTGCAGTGGAATCAGAGAGTGTTTTTGCATCACAAACGACAGATAGCCAAGTATGTAATCAACAGCGAAATAGTAGTATGCAAGAAGGGTCGCAGTCGTTTACTACAAATCCTTGCTCAGCAACGATAAATAACATCAGCAGACAGCAAGGAGACGGTGCTAATTCAAGCCGTCAGCAAACGCTTCATCAAATGGCAACACCGCACCATCAAATACCAACACCGCAAGAACAAACGCCCTTGTCCAACAGTATCAGTGGATCGTGCACAATTCGGCGACAAAGTTCAAGCTCGATCACACCAGTTGTCCATGCAAATGGCTCCTTTTCGCAACAGAATATTTTACAAGTCAGTCACAGTGGTCACATACAAGCGATCCCGGGTCAGTTTCATGGTGCTGGATATGCCCCAGGGTACCCCCCAGACATGCAGTTTGCAAGACCCGCAGTCGTCCCTGCCCAGGCGCCTCAGGAAACTATTGTGGTGAAGGGCAAAACGTACCAGAAGTTGGGAACTATCGGCAAGGGAGGGTCCAGCAAGGTATTCCAAGCATTTGATGGAAAAAGAATATGCGCCATAAAGTACGTAAATTTAGAAGAAGCAGATGACTTTATCGTTCAAAGTTACATCAACGAAGTTCAATTGCTGGAGAGACTGCAGGGAAATGATAACATTGTCAAACTGTTTGACTGGGAACTAAGCCAAGAGAAGAGCCACTTAATTTTAGTTATGGAATGCGGAAGTATCGACCTGGCGGGTTTCTTGAGAAAAAATCGTACAAAAATAACAGAGGGTGAGCTTCAGGTGTTCTGGAGGCAAATGCTGGAAGCTGTTCACGTGATTCATGAGGCGCGCATCATTCACAGCGACCTGAAACCTGCTAACTTCCTGTTGGTGGAAGGACGATTAAAACTTATCGATTTCGGAATCGCTAATGCTTTACAAGGAGACAAGACAAGTATAGAGCTTAACACACAGGTTGGCACGTTAAACTTCATGTCCCCAGAAGCATTTCAAGACATCTCTCACGCGCCGCGATTCGACAATGCAGGAAATGCAAAACCAAGAATGAAGATCGGCCGTGCCAGCGATGTGTGGTCCCTAGGCTGTATCCTGTACATGATGGTTTATGGCAAGACGCCTTTCCAACATATCACCAATCACGTTGTTAAGTTACAATGCATTATGGATCCTTCACACGTCATCGAGTTCCCGGATATCAAAGACAAGCGCCTGCTTGACGTCATGAAGGGCTGTCTTCGCCGGTCTCCTAAGGAGCGCTACAGTATTCCACATCTGTTAGCTCACCCTTACATTGATCCGTCGGCACACGATCCCCTGGTAGAGATTGAGGACGAGGATAAAATGTTTGACGTCCTGATGGAGTTTGCAAAAGCGGACGTTAACTCGCCACGATCAGTTAGAGCTCTTAGCAAGAGTTTCTATAAACAGCTTCTCACTAGTAAAAAGGTCAGCATCTCATCTGCTGTACCCAGACCCCCTGGTCCTGTTCATTCCCAGCATGCAATGCCACCTCGCCAGCCTCCTCCAGGCCCTGCTGTCCGTCAGCCATTGGTTGGAATTGACTTACAAGCGTTAAATCAGGCACAGAAGGCATTAAAACCTCCCCACGCGTCAGGAAATGCGAAGTACATGAGAGGGAATGCTAACGAACAGAATAAGGAAAACGCGGATCTTAATGGGTTACTTAAGCACGAGCTTGTTGAAAAATACAAGAATGCACTTCCTCACGACACGTCCGAGTCCACATTTGAACAAACCTGGAACACAACATATGGGAAGTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q4R945	Dual specificity protein kinase TTK OS=Macaca fascicularis OX=9541 GN=TTK PE=2 SV=1
P33981	Dual specificity protein kinase TTK OS=Homo sapiens OX=9606 GN=TTK PE=1 SV=2
Q8AYG3	Dual specificity protein kinase Ttk OS=Danio rerio OX=7955 GN=ttk PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003483 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00069 all species →	Pkinase	Protein kinase domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000719 all species →	Domain	Protein kinase domain	Interproscan
IPR011990 all species →	Homologous_superfamily	Tetratricopeptide-like helical domain superfamily	Interproscan
IPR017441 all species →	Binding_site	Protein kinase, ATP binding site	Interproscan
IPR011009 all species →	Homologous_superfamily	Protein kinase-like domain superfamily	Interproscan
IPR027084 all species →	Domain	Protein kinase Mps1 family, catalytic domain	Interproscan
IPR008271 all species →	Active_site	Serine/threonine-protein kinase, active site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR22974 all species →	MIXED LINEAGE PROTEIN KINASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004672 all species →	Molecular Function	protein kinase activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0006468 all species →	Biological Process	protein phosphorylation	Interproscan
GO:0000776 all species →	Cellular Component	kinetochore	Interproscan
GO:0004674 all species →	Molecular Function	protein serine/threonine kinase activity	Interproscan
GO:0004712 all species →	Molecular Function	protein serine/threonine/tyrosine kinase activity	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0007059 all species →	Biological Process	chromosome segregation	Interproscan
GO:0007094 all species →	Biological Process	mitotic spindle assembly checkpoint signaling	Interproscan
GO:0018105 all species →	Biological Process	peptidyl-serine phosphorylation	Interproscan
GO:0033316 all species →	Biological Process	meiotic spindle assembly checkpoint signaling	Interproscan
GO:0034501 all species →	Biological Process	protein localization to kinetochore	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K08866	TTK, MPS1; serine/threonine-protein kinase TTK/MPS1	EC:2.7.12.1	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of evm.model.Ap1.3024 across 49 RNA-seq samples of Astrangia poculata. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

49Samples

0TPM > 0

4Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole organism · cold control	14	0	0.00	0.00
whole organism · heat control	12	0	0.00	0.00
whole organism · cold challenge	12	0	0.00	0.00
whole organism · heat challenge	11	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR10674714	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674715	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674724	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674733	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674734	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674735	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674736	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674737	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674739	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674743	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674746	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674747	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674748	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674750	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674706	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674707	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674708	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674717	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674718	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674720	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674721	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674725	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674731	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674741	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674752	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674753	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674711	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674712	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674713	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674722	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674723	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674730	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674732	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674738	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674740	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674744	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674745	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674749	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674709	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674710	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674716	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674719	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674726	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674727	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674728	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674729	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674742	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674751	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674754	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293

Source: CnidoSite RNA-seq expression matrices (APOCU_TPM, StringTie quantification over 49 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.