Gene detail

Detailed information of evm.model.Ap1.3649 in Astrangia poculata

Genomic Location: Ap1:37700681...37719282
NR annotation: XP_027043218.1, ATP-dependent DNA helicase Q5-like [Pocillopora damicornis]
Species Astrangia poculata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

evm.model.Ap1.3649

atggcaacacaagttttaactgattcattgaagagtgtgtttaagcatagtgacttcaagtcaaagcttcaaaaagaagcaatagagtgtcttcatgaaggaaaacgggatgtgtttgtatccatgccaactggatcaggaaaatctctttgttatcaactgccagcagttttggctaaaggaataacagttatattttctccactgattgctctaattcaagatcaagtattgcaattaaaatccctgtccataaaagttgaaacattaaactcaaaactaacagcatctgagagaaagcgagtctattcggaaattcaaaaactgaagccatcaatcaagcttttgtatattactcctgaactcgcggcaacacctggatttcagaaagtactgagctctctgtacaagagaaagcttttgtcgttctttgttgtggatgaggcacattgcgtttcacagtggggacatgattttagacctgattacctgaagcttggcttattaagaaaacagtttagtgatgttccatgggcagcgctcacagcaactgcaactcctcatgtccaagaggatgttctggcatctctgcagctgcacaaacccacagcaattttcaagactacttgctatcgaccaaatttattttatgatgtgtgtttcaaggaactccttgatgatccttattcagacctcaaaagttttgctgactcagcattatcagaacaagacagcagtaatggcgagaagggtagtggcattatttattgtcgcactcgagatgcttgtcaagaagtggcatcaaggctaaacagaaagggactctccgcaaaggcttatcatgctggccttaaaccagctaaacgagatgagattcaacaggaatggatggatgggaaagttgcagttattgttgcaactattagttttggtatgggagttgataaagcgtctgtcaggtttgttgtacactggactttgccgcaatcaatggaaggttactaccaagaatcaggcagagccggcagggatggaaagccttccttctgcaagttatattactccaggcttgagagagatcaagtgttttttctcattaaaaaaggaatcaaagaaaagaagagcaaattgtccagtggaagaaagaatgaggcgattcagtccagttatgaggcgattgttaaatactgtgaagaacccagctgtagacacgctctaatagcttcatattttggagacagcaaaccaaagtgcgcaaaaggttgtgattactgcaaagatcctgatgcagttgacgagcttgtggatcactggcgtcgtggcgtgatggcgggacacaacagaagcgtgacagcgggaaggacttatattgcacacatgtcgagcggagaggatggcgagctttatggaggaggaaaatggggacacgacagaaagttatatgatgatgatgacaatgaagatgacagcgagggaggctctgaggaagagcgagcattccgatgtaaattgattgcaaatgagtttaggaaacgacgcaagggaaaacaatcgctgtcctatccagttagtcctcagttaccgggtcccaattgtcgcctcaaagaagcttcaaactatctgcacatcccgaaactttccatcaaggtgagggaacactgtttcggtctgttagaggaagcgatgaaatcaaacatcaatcagtgtgccaagatggacgattctgcgaggttgttgtttgatatggagtccacattaattgatatcgagcatagcatcttcaagaacagcaaaacagacatcggttacaagactgccatgctgaaaaaggttagcgaggtgaaatccagcaccactaatggcagcgtttttgtttggagcggagcttcaaaaaacaacacagcaacatccactgtatctttggcctcaagtgataatgtacaacaggaaattaacaaggagccagaggaagctgacaccaaggaatacactccatttgtgtctgcgttacagctggtgaaatcaaacagtagagtaacaaaagaacctgttgtatttaaacaaccaacaaagattcccactcctagagtgattccaacaataaagtacttctttgagaacagtgataaaagtgaagtccaacaacaacaacaacagcagcagcagcaggaggaagaacaagcagatgatagtggcaaaatatccactaacagccacaagagaacagcttcagagggtttttggtggttggacgatgctcctttacacaagaagtcaagactagaagataaatctacaacagatacgtgtacaaacagtaaaaatagaggagatgctaaagacacggcgattccgagtgacgttttcttcagaaaagcgtcggaattaaagcctttaaaacgtctcaaccacaacttgaacatcagtacttctttcaagcttaaagacaagtcaactggaatgaagacacttgacaattttttacataaggacagcccgtcctcgaccaatttttcacgattaaaactaaacacacagactgtaagcaaagacaatcatgacaggagaaggtctggtgaaggatcgtcacatggtagccatggtaacgtctcccctggggaccctgctggtgtgaaggacgtggccaatgtggttgtcaagtacttgtctccttacctcaaacagggctctattgtctccaaggaattgtttaagttcttagctcgctgcattacccacagagtcatgggaactggaaaagcgtcatcgccctcttcgagaaaactggaagtcaaagcgaccgtgaagaaactgtttgaagtgtgcaggaaatttgagcaggagagtgactgggataaatacattagagctgttgaataa

Transcript

evm.model.Ap1.3649

ATGGCAACACAAGTTTTAACTGATTCATTGAAGAGTGTGTTTAAGCATAGTGACTTCAAGTCAAAGCTTCAAAAAGAAGCAATAGAGTGTCTTCATGAAGGAAAACGGGATGTGTTTGTATCCATGCCAACTGGATCAGGAAAATCTCTTTGTTATCAACTGCCAGCAGTTTTGGCTAAAGGAATAACAGTTATATTTTCTCCACTGATTGCTCTAATTCAAGATCAAGTATTGCAATTAAAATCCCTGTCCATAAAAGTTGAAACATTAAACTCAAAACTAACAGCATCTGAGAGAAAGCGAGTCTATTCGGAAATTCAAAAACTGAAGCCATCAATCAAGCTTTTGTATATTACTCCTGAACTCGCGGCAACACCTGGATTTCAGAAAGTACTGAGCTCTCTGTACAAGAGAAAGCTTTTGTCGTTCTTTGTTGTGGATGAGGCACATTGCGTTTCACAGTGGGGACATGATTTTAGACCTGATTACCTGAAGCTTGGCTTATTAAGAAAACAGTTTAGTGATGTTCCATGGGCAGCGCTCACAGCAACTGCAACTCCTCATGTCCAAGAGGATGTTCTGGCATCTCTGCAGCTGCACAAACCCACAGCAATTTTCAAGACTACTTGCTATCGACCAAATTTATTTTATGATGTGTGTTTCAAGGAACTCCTTGATGATCCTTATTCAGACCTCAAAAGTTTTGCTGACTCAGCATTATCAGAACAAGACAGCAGTAATGGCGAGAAGGGTAGTGGCATTATTTATTGTCGCACTCGAGATGCTTGTCAAGAAGTGGCATCAAGGCTAAACAGAAAGGGACTCTCCGCAAAGGCTTATCATGCTGGCCTTAAACCAGCTAAACGAGATGAGATTCAACAGGAATGGATGGATGGGAAAGTTGCAGTTATTGTTGCAACTATTAGTTTTGGTATGGGAGTTGATAAAGCGTCTGTCAGGTTTGTTGTACACTGGACTTTGCCGCAATCAATGGAAGGTTACTACCAAGAATCAGGCAGAGCCGGCAGGGATGGAAAGCCTTCCTTCTGCAAGTTATATTACTCCAGGCTTGAGAGAGATCAAGTGTTTTTTCTCATTAAAAAAGGAATCAAAGAAAAGAAGAGCAAATTGTCCAGTGGAAGAAAGAATGAGGCGATTCAGTCCAGTTATGAGGCGATTGTTAAATACTGTGAAGAACCCAGCTGTAGACACGCTCTAATAGCTTCATATTTTGGAGACAGCAAACCAAAGTGCGCAAAAGGTTGTGATTACTGCAAAGATCCTGATGCAGTTGACGAGCTTGTGGATCACTGGCGTCGTGGCGTGATGGCGGGACACAACAGAAGCGTGACAGCGGGAAGGACTTATATTGCACACATGTCGAGCGGAGAGGATGGCGAGCTTTATGGAGGAGGAAAATGGGGACACGACAGAAAGTTATATGATGATGATGACAATGAAGATGACAGCGAGGGAGGCTCTGAGGAAGAGCGAGCATTCCGATGTAAATTGATTGCAAATGAGTTTAGGAAACGACGCAAGGGAAAACAATCGCTGTCCTATCCAGTTAGTCCTCAGTTACCGGGTCCCAATTGTCGCCTCAAAGAAGCTTCAAACTATCTGCACATCCCGAAACTTTCCATCAAGGTGAGGGAACACTGTTTCGGTCTGTTAGAGGAAGCGATGAAATCAAACATCAATCAGTGTGCCAAGATGGACGATTCTGCGAGGTTGTTGTTTGATATGGAGTCCACATTAATTGATATCGAGCATAGCATCTTCAAGAACAGCAAAACAGACATCGGTTACAAGACTGCCATGCTGAAAAAGGTTAGCGAGGTGAAATCCAGCACCACTAATGGCAGCGTTTTTGTTTGGAGCGGAGCTTCAAAAAACAACACAGCAACATCCACTGTATCTTTGGCCTCAAGTGATAATGTACAACAGGAAATTAACAAGGAGCCAGAGGAAGCTGACACCAAGGAATACACTCCATTTGTGTCTGCGTTACAGCTGGTGAAATCAAACAGTAGAGTAACAAAAGAACCTGTTGTATTTAAACAACCAACAAAGATTCCCACTCCTAGAGTGATTCCAACAATAAAGTACTTCTTTGAGAACAGTGATAAAAGTGAAGTCCAACAACAACAACAACAGCAGCAGCAGCAGGAGGAAGAACAAGCAGATGATAGTGGCAAAATATCCACTAACAGCCACAAGAGAACAGCTTCAGAGGGTTTTTGGTGGTTGGACGATGCTCCTTTACACAAGAAGTCAAGACTAGAAGATAAATCTACAACAGATACGTGTACAAACAGTAAAAATAGAGGAGATGCTAAAGACACGGCGATTCCGAGTGACGTTTTCTTCAGAAAAGCGTCGGAATTAAAGCCTTTAAAACGTCTCAACCACAACTTGAACATCAGTACTTCTTTCAAGCTTAAAGACAAGTCAACTGGAATGAAGACACTTGACAATTTTTTACATAAGGACAGCCCGTCCTCGACCAATTTTTCACGATTAAAACTAAACACACAGACTGTAAGCAAAGACAATCATGACAGGAGAAGGTCTGGTGAAGGATCGTCACATGGTAGCCATGGTAACGTCTCCCCTGGGGACCCTGCTGGTGTGAAGGACGTGGCCAATGTGGTTGTCAAGTACTTGTCTCCTTACCTCAAACAGGGCTCTATTGTCTCCAAGGAATTGTTTAAGTTCTTAGCTCGCTGCATTACCCACAGAGTCATGGGAACTGGAAAAGCGTCATCGCCCTCTTCGAGAAAACTGGAAGTCAAAGCGACCGTGAAGAAACTGTTTGAAGTGTGCAGGAAATTTGAGCAGGAGAGTGACTGGGATAAATACATTAGAGCTGTTGAATAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O94762	ATP-dependent DNA helicase Q5 OS=Homo sapiens OX=9606 GN=RECQL5 PE=1 SV=2
D4ACP5	ATP-dependent DNA helicase Q5 OS=Rattus norvegicus OX=10116 GN=Recql5 PE=1 SV=1
Q8VID5	ATP-dependent DNA helicase Q5 OS=Mus musculus OX=10090 GN=Recql5 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000285 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF16124 all species →	RecQ_Zn_bind	RecQ zinc-binding	Domain	Interproscan
PF00270 all species →	DEAD	DEAD/DEAH box helicase	Domain	Interproscan
PF00271 all species →	Helicase_C	Helicase conserved C-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR014001 all species →	Domain	Helicase superfamily 1/2, ATP-binding domain	Interproscan
IPR032284 all species →	Domain	ATP-dependent DNA helicase RecQ, zinc-binding domain	Interproscan
IPR002464 all species →	Conserved_site	DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR001650 all species →	Domain	Helicase, C-terminal domain-like	Interproscan
IPR004589 all species →	Family	DNA helicase, ATP-dependent, RecQ type	Interproscan
IPR038190 all species →	Homologous_superfamily	Set2 Rpb1 interacting domain superfamily	Interproscan
IPR011545 all species →	Domain	DEAD/DEAH box helicase domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13710 all species →	DNA HELICASE RECQ FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000724 all species →	Biological Process	double-strand break repair via homologous recombination	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005694 all species →	Cellular Component	chromosome	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0006268 all species →	Biological Process	DNA unwinding involved in DNA replication	Interproscan
GO:0006281 all species →	Biological Process	DNA repair	Interproscan
GO:0006310 all species →	Biological Process	DNA recombination	Interproscan
GO:0009378 all species →	Molecular Function	four-way junction helicase activity	Interproscan
GO:0032508 all species →	Biological Process	DNA duplex unwinding	Interproscan
GO:0043138 all species →	Molecular Function	3'-5' DNA helicase activity	Interproscan
GO:0004386 all species →	Molecular Function	helicase activity	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10902	RECQL5; ATP-dependent DNA helicase Q5	EC:5.6.2.4	DNA repair and recombination proteins	ko03400	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of evm.model.Ap1.3649 across 49 RNA-seq samples of Astrangia poculata. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

49Samples

0TPM > 0

4Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole organism · cold control	14	0	0.00	0.00
whole organism · heat control	12	0	0.00	0.00
whole organism · cold challenge	12	0	0.00	0.00
whole organism · heat challenge	11	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR10674714	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674715	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674724	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674733	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674734	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674735	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674736	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674737	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674739	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674743	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674746	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674747	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674748	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674750	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674706	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674707	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674708	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674717	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674718	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674720	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674721	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674725	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674731	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674741	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674752	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674753	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674711	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674712	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674713	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674722	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674723	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674730	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674732	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674738	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674740	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674744	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674745	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674749	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674709	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674710	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674716	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674719	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674726	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674727	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674728	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674729	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674742	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674751	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674754	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293

Source: CnidoSite RNA-seq expression matrices (APOCU_TPM, StringTie quantification over 49 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.