Gene detail

Detailed information of evm.model.Ap11.1751 in Astrangia poculata

Genomic Location: Ap11:19203671...19225431
NR annotation: KAJ7340049.1, hypothetical protein OS493_002772 [Desmophyllum pertusum]
Species Astrangia poculata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

evm.model.Ap11.1751

atgagcgctgaagaacgatctgataattctggtcatacagacgaaagtgggtctgatagtgaggaagatgtgtcaggcgaacatgtcatttcttccacagaagaatatcagcctccttattatgagcatgttgaggagaatgtgtatttatttgacaggaagaagaaagtcaataaggaagtgcggaggatgcaatgtgattgtacccttgatgcggattaccctgattctgctggttgcggggaggactgtctgaatagactgttgatgattgaatgtaacagcagatgtacttgtggggagatgtgtagtaacaagagatttcaacagggatgtaaagtaaaagttgaagtttttaaaacagagaacaaaggctggggtttaaaaactcttgaagatcttgagccaaatcagtttgttatggagtattgcggcgaagtaatgaactacaaagatttctcggagcgagcagagcgttacgacagagagaacaggaggcattattactttatgacactaagagcagatgagatcattgatgccacttttaaagggaacttatcaagatttatcaaccatagttgtgattcaaactgtgaaacccagaagtggactgtcaatggcttgttaaggattggatttttcactcaaagattcatccctgccagaacagagctaacatttgactacaaactgcagcgctatggaaaaactgctcagatttgctactgtgaagcaccaaattgccgtggatttattggaggcgaaaaacaaactcccctgaagaacacagtggaaagaatagcaactccacccataacaagctcaccaagaaggaggcgtaaaaaaccgaggaacttgacaagcgagtttgatgatataacgctggaagatgaggtggaaaagctgcttggcgatcagcaaggtttggtccatggtgaccaggcattaaaactgtcacgactgatggttcgagcggagaccacagagcagaggatcatgctgcttaaaatcctgcagcacactacagaccagtcttgtttgaaggcgttcctaagatttcaaggtttgtctcttctgtggagctggatgattgatggtggagggaaaagaatgaaacttaaaatggagttgcttgatacattgaaacaccttccaattgccactaagaatcagcttgaagacagtaaagtaataaaggttgtcagaaaatgggcattatcatcctgtccaacagttgaagctggctctagcagtggacaggagtcgcatggcaacagcccggcagattctgaatgtaccgcgggaacagaagataatgacgacgataaccaacaccggacaaaaccgcttgaaattggcaagaaattggttggtagcccacttatttttgaaaggcagtgctctaataaggaccaatcagacgacgactctttggatgccgaagttgctagcttcattgttaacaagtcggctgatagtggagcagtgaaaagcaagatggccgcagagtgtgaaaagtctccggatgagctttcagaggatgatgttaggtctgaggatgagcgattgcctgaaactggagttgggatgatagccaatgagctgttaaagtcctggagtctacttaaggaagtctataaaataccaaagaaatctgcgacaccagctaaacaggaccgtgtcactgaattggcagcagcggcatgcagcccagcaggaagcgctgatggtgatcattctaggactccagtcgaacatatcagttccccaggcaaattggatgccatcatgaagagtcttcagaactcatccaaaccgctgtttcctctggaatcaaggaccccgcctgcctcccagggattctcaacctgtagtgaagaaactgatgagcagaaaagctccgcaaatgagccgcctcccacaaaagctggcgatttcagcttattagagtttgacgatgacatggaaactaaagaaagttcaactcctgataaagaggatgtgacccacccacttccattgttgtcagaccctgttgatgtatcacaggatcaagatactagatcacagaatgcaatgcagacatttggatatcagcagcgcatgaattttaatgtggagcatggatttggccaacaaaagcccaaacggaacaaaaagaaaaataagaagtggaatcagaatcaaatgcagaattttttccaacaacagggaaggaacgttcaaggtttactggataacaactttgggaatattcacatgaaccctcaaacaaactttggaccacagcaaaacatgacccagtggagaggcccatctcaaaatgcacctccaaattaccagggaaaccagttttactgcggtggacctacagttggacaagaccagggtcctagaccccaacatttgggccaaggtaattttgtgggaaatttcaacccgcaaggccctgcattgccaaactttaatgttcctccccctaatatgcctccaatggaatttttccgtaaagtgccgccgccaaacttttcgcaacaaaatcaaccaatgatgcctcagcagccgcaacaaactccacacatcccgccacagccagttcctcctcctccgctccaggctaaccaatcgcagttcttctctccatcccaaccaccgccttacactcggcttcctcccccgccccctttccaagcaaatgtgtccactccaccacccccacagtttcaacagcccaatgccatgcaacagcagcagcatccaaggagcatgcaacccggcttccctccacagcaaaatcaatttccatacaattcaccgcctccgcagcttagtatcccgccagctcagcagataagtcctgtgggaaaacttccgatacctccccagcatcggtctggtttgcccgaggcagtgccacatccagaggtggcgccattctctcttcaaaccggtgcagtgacaacatcctcaacagggagctatgaatgcagtgaaggctttggggcagaaccggagccttgtacgccatcacctgtgaagcataaaccaacacatctgccgccacattggaagtcagcgacggaccaacaaggaaaagtttactactaccatgcattaacaaggaaaactcagtgggatcttccaagctgggatagcagtccatcttcagaagaggaacatccttgtaatgtcacagaacctgaaaatacaagcgtcacgccccacacttacaccaaaatggaagaggagtcaccaaaagcaaaagtaaagaaaatggttaagactccgacaactcccccagggaccccccctgagagccccaccctggcgtatacaacagctgcagcagatactacagatactgcacaccagagagaggaacacatgataagagatgacgcttctactggctcgtcgtcacaccataaaatcagggagatgtttagaatgaagctttccaatgtggttgtgaactgccttaatcctttcttcaaagtcgactgtaaatcaggcaggatcctgaatacagacgatttcaagtttttagctagaaagctaacccatggaattttgatgaaggagcttagccacttaaaagatgaagaaacattgcagtgcaatgattccgtcaaaatcaagactaaagaatatattcgaagttatatgaaaaaatttggtcctgtgtataaacggtcttag

Transcript

evm.model.Ap11.1751

ATGAGCGCTGAAGAACGATCTGATAATTCTGGTCATACAGACGAAAGTGGGTCTGATAGTGAGGAAGATGTGTCAGGCGAACATGTCATTTCTTCCACAGAAGAATATCAGCCTCCTTATTATGAGCATGTTGAGGAGAATGTGTATTTATTTGACAGGAAGAAGAAAGTCAATAAGGAAGTGCGGAGGATGCAATGTGATTGTACCCTTGATGCGGATTACCCTGATTCTGCTGGTTGCGGGGAGGACTGTCTGAATAGACTGTTGATGATTGAATGTAACAGCAGATGTACTTGTGGGGAGATGTGTAGTAACAAGAGATTTCAACAGGGATGTAAAGTAAAAGTTGAAGTTTTTAAAACAGAGAACAAAGGCTGGGGTTTAAAAACTCTTGAAGATCTTGAGCCAAATCAGTTTGTTATGGAGTATTGCGGCGAAGTAATGAACTACAAAGATTTCTCGGAGCGAGCAGAGCGTTACGACAGAGAGAACAGGAGGCATTATTACTTTATGACACTAAGAGCAGATGAGATCATTGATGCCACTTTTAAAGGGAACTTATCAAGATTTATCAACCATAGTTGTGATTCAAACTGTGAAACCCAGAAGTGGACTGTCAATGGCTTGTTAAGGATTGGATTTTTCACTCAAAGATTCATCCCTGCCAGAACAGAGCTAACATTTGACTACAAACTGCAGCGCTATGGAAAAACTGCTCAGATTTGCTACTGTGAAGCACCAAATTGCCGTGGATTTATTGGAGGCGAAAAACAAACTCCCCTGAAGAACACAGTGGAAAGAATAGCAACTCCACCCATAACAAGCTCACCAAGAAGGAGGCGTAAAAAACCGAGGAACTTGACAAGCGAGTTTGATGATATAACGCTGGAAGATGAGGTGGAAAAGCTGCTTGGCGATCAGCAAGGTTTGGTCCATGGTGACCAGGCATTAAAACTGTCACGACTGATGGTTCGAGCGGAGACCACAGAGCAGAGGATCATGCTGCTTAAAATCCTGCAGCACACTACAGACCAGTCTTGTTTGAAGGCGTTCCTAAGATTTCAAGGTTTGTCTCTTCTGTGGAGCTGGATGATTGATGGTGGAGGGAAAAGAATGAAACTTAAAATGGAGTTGCTTGATACATTGAAACACCTTCCAATTGCCACTAAGAATCAGCTTGAAGACAGTAAAGTAATAAAGGTTGTCAGAAAATGGGCATTATCATCCTGTCCAACAGTTGAAGCTGGCTCTAGCAGTGGACAGGAGTCGCATGGCAACAGCCCGGCAGATTCTGAATGTACCGCGGGAACAGAAGATAATGACGACGATAACCAACACCGGACAAAACCGCTTGAAATTGGCAAGAAATTGGTTGGTAGCCCACTTATTTTTGAAAGGCAGTGCTCTAATAAGGACCAATCAGACGACGACTCTTTGGATGCCGAAGTTGCTAGCTTCATTGTTAACAAGTCGGCTGATAGTGGAGCAGTGAAAAGCAAGATGGCCGCAGAGTGTGAAAAGTCTCCGGATGAGCTTTCAGAGGATGATGTTAGGTCTGAGGATGAGCGATTGCCTGAAACTGGAGTTGGGATGATAGCCAATGAGCTGTTAAAGTCCTGGAGTCTACTTAAGGAAGTCTATAAAATACCAAAGAAATCTGCGACACCAGCTAAACAGGACCGTGTCACTGAATTGGCAGCAGCGGCATGCAGCCCAGCAGGAAGCGCTGATGGTGATCATTCTAGGACTCCAGTCGAACATATCAGTTCCCCAGGCAAATTGGATGCCATCATGAAGAGTCTTCAGAACTCATCCAAACCGCTGTTTCCTCTGGAATCAAGGACCCCGCCTGCCTCCCAGGGATTCTCAACCTGTAGTGAAGAAACTGATGAGCAGAAAAGCTCCGCAAATGAGCCGCCTCCCACAAAAGCTGGCGATTTCAGCTTATTAGAGTTTGACGATGACATGGAAACTAAAGAAAGTTCAACTCCTGATAAAGAGGATGTGACCCACCCACTTCCATTGTTGTCAGACCCTGTTGATGTATCACAGGATCAAGATACTAGATCACAGAATGCAATGCAGACATTTGGATATCAGCAGCGCATGAATTTTAATGTGGAGCATGGATTTGGCCAACAAAAGCCCAAACGGAACAAAAAGAAAAATAAGAAGTGGAATCAGAATCAAATGCAGAATTTTTTCCAACAACAGGGAAGGAACGTTCAAGGTTTACTGGATAACAACTTTGGGAATATTCACATGAACCCTCAAACAAACTTTGGACCACAGCAAAACATGACCCAGTGGAGAGGCCCATCTCAAAATGCACCTCCAAATTACCAGGGAAACCAGTTTTACTGCGGTGGACCTACAGTTGGACAAGACCAGGGTCCTAGACCCCAACATTTGGGCCAAGGTAATTTTGTGGGAAATTTCAACCCGCAAGGCCCTGCATTGCCAAACTTTAATGTTCCTCCCCCTAATATGCCTCCAATGGAATTTTTCCGTAAAGTGCCGCCGCCAAACTTTTCGCAACAAAATCAACCAATGATGCCTCAGCAGCCGCAACAAACTCCACACATCCCGCCACAGCCAGTTCCTCCTCCTCCGCTCCAGGCTAACCAATCGCAGTTCTTCTCTCCATCCCAACCACCGCCTTACACTCGGCTTCCTCCCCCGCCCCCTTTCCAAGCAAATGTGTCCACTCCACCACCCCCACAGTTTCAACAGCCCAATGCCATGCAACAGCAGCAGCATCCAAGGAGCATGCAACCCGGCTTCCCTCCACAGCAAAATCAATTTCCATACAATTCACCGCCTCCGCAGCTTAGTATCCCGCCAGCTCAGCAGATAAGTCCTGTGGGAAAACTTCCGATACCTCCCCAGCATCGGTCTGGTTTGCCCGAGGCAGTGCCACATCCAGAGGTGGCGCCATTCTCTCTTCAAACCGGTGCAGTGACAACATCCTCAACAGGGAGCTATGAATGCAGTGAAGGCTTTGGGGCAGAACCGGAGCCTTGTACGCCATCACCTGTGAAGCATAAACCAACACATCTGCCGCCACATTGGAAGTCAGCGACGGACCAACAAGGAAAAGTTTACTACTACCATGCATTAACAAGGAAAACTCAGTGGGATCTTCCAAGCTGGGATAGCAGTCCATCTTCAGAAGAGGAACATCCTTGTAATGTCACAGAACCTGAAAATACAAGCGTCACGCCCCACACTTACACCAAAATGGAAGAGGAGTCACCAAAAGCAAAAGTAAAGAAAATGGTTAAGACTCCGACAACTCCCCCAGGGACCCCCCCTGAGAGCCCCACCCTGGCGTATACAACAGCTGCAGCAGATACTACAGATACTGCACACCAGAGAGAGGAACACATGATAAGAGATGACGCTTCTACTGGCTCGTCGTCACACCATAAAATCAGGGAGATGTTTAGAATGAAGCTTTCCAATGTGGTTGTGAACTGCCTTAATCCTTTCTTCAAAGTCGACTGTAAATCAGGCAGGATCCTGAATACAGACGATTTCAAGTTTTTAGCTAGAAAGCTAACCCATGGAATTTTGATGAAGGAGCTTAGCCACTTAAAAGATGAAGAAACATTGCAGTGCAATGATTCCGTCAAAATCAAGACTAAAGAATATATTCGAAGTTATATGAAAAAATTTGGTCCTGTGTATAAACGGTCTTAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
E9Q5F9	Histone-lysine N-methyltransferase SETD2 OS=Mus musculus OX=10090 GN=Setd2 PE=1 SV=1
Q9BYW2	Histone-lysine N-methyltransferase SETD2 OS=Homo sapiens OX=9606 GN=SETD2 PE=1 SV=3
Q9VYD1	Histone-lysine N-methyltransferase Set2 OS=Drosophila melanogaster OX=7227 GN=Set2 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004034 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00856 all species →	SET	SET domain	Family	Interproscan
PF00397 all species →	WW	WW domain	Domain	Interproscan
PF17907 all species →	AWS	AWS domain	Domain	Interproscan
PF08236 all species →	SRI	SRI (Set2 Rpb1 interacting) domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001214 all species →	Domain	SET domain	Interproscan
IPR003616 all species →	Domain	Post-SET domain	Interproscan
IPR046341 all species →	Homologous_superfamily	SET domain superfamily	Interproscan
IPR036020 all species →	Homologous_superfamily	WW domain superfamily	Interproscan
IPR001202 all species →	Domain	WW domain	Interproscan
IPR006560 all species →	Domain	AWS domain	Interproscan
IPR038190 all species →	Homologous_superfamily	Set2 Rpb1 interacting domain superfamily	Interproscan
IPR035441 all species →	Homologous_superfamily	TFIIS/LEDGF domain superfamily	Interproscan
IPR013257 all species →	Domain	Set2 Rpb1 interacting domain	Interproscan
IPR044437 all species →	Domain	SETD2/Set2, SET domain	Interproscan
IPR042294 all species →	Family	Histone-lysine N-methyltransferase SETD2, animal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46711 all species →	HISTONE-LYSINE N-METHYLTRANSFERASE SETD2	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0042054 all species →	Molecular Function	histone methyltransferase activity	Interproscan
GO:0005694 all species →	Cellular Component	chromosome	Interproscan
GO:0006355 all species →	Biological Process	regulation of DNA-templated transcription	Interproscan
GO:0046975 all species →	Molecular Function	histone H3K36 methyltransferase activity	Interproscan
GO:0016279 all species →	Molecular Function	protein-lysine N-methyltransferase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11423	SETD2; [histone H3]-lysine36 N-trimethyltransferase	EC:2.1.1.359	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of evm.model.Ap11.1751 across 49 RNA-seq samples of Astrangia poculata. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

49Samples

0TPM > 0

4Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole organism · cold control	14	0	0.00	0.00
whole organism · heat control	12	0	0.00	0.00
whole organism · cold challenge	12	0	0.00	0.00
whole organism · heat challenge	11	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR10674714	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674715	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674724	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674733	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674734	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674735	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674736	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674737	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674739	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674743	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674746	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674747	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674748	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674750	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674706	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674707	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674708	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674717	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674718	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674720	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674721	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674725	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674731	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674741	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674752	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674753	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674711	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674712	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674713	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674722	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674723	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674730	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674732	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674738	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674740	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674744	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674745	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674749	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674709	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674710	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674716	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674719	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674726	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674727	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674728	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674729	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674742	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674751	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674754	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293

Source: CnidoSite RNA-seq expression matrices (APOCU_TPM, StringTie quantification over 49 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.