Gene detail

Detailed information of evm.model.Ap11.81 in Astrangia poculata

Genomic Location: Ap11:1075652...1091596
NR annotation: XP_020600683.1, anion exchange protein 3-like [Orbicella faveolata]
Species Astrangia poculata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

evm.model.Ap11.81

gagattgaacctatccaagaacggctggcaacagaaaaggatgaagcaagcgtgttggcaaaaaaagatttggaagagatggcatggcatcgttttgaggacttaagaggacttaggaggcgccgtcctcatcttccacggcataaatcaggaatgaagactcactatagcatctcagacataagcaaaagcttacagagattccctgtgaagtacgaccatagtcctcatgaggcatttgttgagttggaacagttaacaaaaaatggcgaggaaatggagtggcaggagacagcacgatggattaagtttgaagagaacgtggaagattctaaccgctggggaaagccacatgtggcttcacttacatttcacagtctgttggaactacgaaaaaacttagaaaaaggcactgtgatgttggacttggaaaaatttgacttgccaagcattgccgaggcagtggttgaaaacatggtgatcacagaccagctaagtcaaacaaacagtaacaaggtgttggcagctttgcttttacgacacagacatcagcatcagatggccccaatcgcacggagaccgtcttcatacaaccttctggctttggcaaggaaagactccaagacagcagcagatgattctgagcagaagatagtggatcctgggggaggtggagcaatggatgacggcgtaatacggctaaggattgatgaaactgatggtgatgacattcctattcaggagacaagccagttgccactgacgactgacaacaaacgagagctgaagcaagaagtttcatttgcccccgaaccccctacagttgagggtggtggaggaaaacaagaatcagacgtaaaatcgaaaattccagaaggggcagaggccacaaccgtccttgtaggaacactagatgagctggaacaaccagtgctagcgtttgtccgtcttgcaaaaggctgtccattgaatatcaccgaggtttccatacctgtgaggttcttgttcgtattgttgggtcctagttctggagaagagtcatactacgaaattggtcgctctgtggctaccttgatgtctgaccaggcattccatgacattgcatatcgagctgactcccgtgaagacctcttgacagccatcaatgggttccttgatgacacagttgttttaccgcctggagagtgggatcgtaatgtcttgttacccatccttgttgctcaaagtaaagccatggcacggagaagaaagatggcgaaagctgcccttgctgctgcagcagaagaacaagaaatagatcccctggaaagaacaggttcgttctgtggtggacttgccctggacatcaaacgacgagcaaaattctacctcagtgactttaaagatggctttaatgtacaatgtctcttgacatcaatttttctttacttttctgtgtttgcaccaaatgttgccttcggcagtcttcttgataagaagacggatggttggctgggtgtgtctgaagttattttcgcaacttgcctttgtggaatactgtttggacttctcgctggacagccactaattattattggagctactggccctgtgttggtttttgagcagactatatatgagttctgtgatgtttatcaattggaattccttccgtggcgctgttggatcggcttctgggtcatgttgatcctgttcggcgtggtggctatggaaggttgttttctggtccgctattttactcggttcactgaagaaatatttgcttgtctcatttctgctatcttcatctacgaagcaatccactttttagaattggtattcaataaaaatcctttgaagaaatcttattcagaatcagaggattcgtctgcagttgaggtgaagggacagccaaacactgcgctcctttccacaatcatggttctaggaactttccttgtggcattttatttgaggaagtttaggacaagttatttttttggaaagaaggccaggaggcttgtaagtgactttggtatcgtcatagcaatggcaacgatgctattacttgacattttccttcacgataaagttaccactccaaagatcgccatcggtgatccaaccaagagaggctttttaccaacaagatacacagagagaggctggtttatcaaccctggaggtatgacaaaagccatggagactggctggattttcgcggctatcattcctgccatgtttgttggaattttgttatttatggaaactgaactgactggagtacttataaacaagaaggaacacaaactaaccaaaggagcaggcttcaatttagatttgtgtgttatgggactgctgtcattcatttgttccttaatgggattgccgtggatgtgcgctgcgactgttcggtcagtctcgcacttgaatgcgctgtccatctggagcacttcgcatgcacctggtgtcaaaccgcaccttatagaagtcaaagaacagagagtcactaatattgcgatacatgtcctcacaggggtatccattctcttagcaccagccctccatctcattccagttccagtcatgtttggtgtcctgttatatcttggtgtttgttcgttatctggtattcagttggtagacagacttatcatgatgtttatgccaccaaagtaccatcctgatgtccagtacgtaagaaaggtgaaaactaaacagattcatagttacaccatgatacagttggtctgcttggctttgctgatttttatcaagttaactgttgtcgcaccgtcattcccgttcttcattatctgtttaattcctttgcgcaagtcgctgaaaaagttttttgaggaaaatgagcttgaagagctcgacaatgaagaagcacccgatgacgacagcgacttggatgagtatgacagtgtgttcctgccaatataa

Transcript

evm.model.Ap11.81

GAGATTGAACCTATCCAAGAACGGCTGGCAACAGAAAAGGATGAAGCAAGCGTGTTGGCAAAAAAAGATTTGGAAGAGATGGCATGGCATCGTTTTGAGGACTTAAGAGGACTTAGGAGGCGCCGTCCTCATCTTCCACGGCATAAATCAGGAATGAAGACTCACTATAGCATCTCAGACATAAGCAAAAGCTTACAGAGATTCCCTGTGAAGTACGACCATAGTCCTCATGAGGCATTTGTTGAGTTGGAACAGTTAACAAAAAATGGCGAGGAAATGGAGTGGCAGGAGACAGCACGATGGATTAAGTTTGAAGAGAACGTGGAAGATTCTAACCGCTGGGGAAAGCCACATGTGGCTTCACTTACATTTCACAGTCTGTTGGAACTACGAAAAAACTTAGAAAAAGGCACTGTGATGTTGGACTTGGAAAAATTTGACTTGCCAAGCATTGCCGAGGCAGTGGTTGAAAACATGGTGATCACAGACCAGCTAAGTCAAACAAACAGTAACAAGGTGTTGGCAGCTTTGCTTTTACGACACAGACATCAGCATCAGATGGCCCCAATCGCACGGAGACCGTCTTCATACAACCTTCTGGCTTTGGCAAGGAAAGACTCCAAGACAGCAGCAGATGATTCTGAGCAGAAGATAGTGGATCCTGGGGGAGGTGGAGCAATGGATGACGGCGTAATACGGCTAAGGATTGATGAAACTGATGGTGATGACATTCCTATTCAGGAGACAAGCCAGTTGCCACTGACGACTGACAACAAACGAGAGCTGAAGCAAGAAGTTTCATTTGCCCCCGAACCCCCTACAGTTGAGGGTGGTGGAGGAAAACAAGAATCAGACGTAAAATCGAAAATTCCAGAAGGGGCAGAGGCCACAACCGTCCTTGTAGGAACACTAGATGAGCTGGAACAACCAGTGCTAGCGTTTGTCCGTCTTGCAAAAGGCTGTCCATTGAATATCACCGAGGTTTCCATACCTGTGAGGTTCTTGTTCGTATTGTTGGGTCCTAGTTCTGGAGAAGAGTCATACTACGAAATTGGTCGCTCTGTGGCTACCTTGATGTCTGACCAGGCATTCCATGACATTGCATATCGAGCTGACTCCCGTGAAGACCTCTTGACAGCCATCAATGGGTTCCTTGATGACACAGTTGTTTTACCGCCTGGAGAGTGGGATCGTAATGTCTTGTTACCCATCCTTGTTGCTCAAAGTAAAGCCATGGCACGGAGAAGAAAGATGGCGAAAGCTGCCCTTGCTGCTGCAGCAGAAGAACAAGAAATAGATCCCCTGGAAAGAACAGGTTCGTTCTGTGGTGGACTTGCCCTGGACATCAAACGACGAGCAAAATTCTACCTCAGTGACTTTAAAGATGGCTTTAATGTACAATGTCTCTTGACATCAATTTTTCTTTACTTTTCTGTGTTTGCACCAAATGTTGCCTTCGGCAGTCTTCTTGATAAGAAGACGGATGGTTGGCTGGGTGTGTCTGAAGTTATTTTCGCAACTTGCCTTTGTGGAATACTGTTTGGACTTCTCGCTGGACAGCCACTAATTATTATTGGAGCTACTGGCCCTGTGTTGGTTTTTGAGCAGACTATATATGAGTTCTGTGATGTTTATCAATTGGAATTCCTTCCGTGGCGCTGTTGGATCGGCTTCTGGGTCATGTTGATCCTGTTCGGCGTGGTGGCTATGGAAGGTTGTTTTCTGGTCCGCTATTTTACTCGGTTCACTGAAGAAATATTTGCTTGTCTCATTTCTGCTATCTTCATCTACGAAGCAATCCACTTTTTAGAATTGGTATTCAATAAAAATCCTTTGAAGAAATCTTATTCAGAATCAGAGGATTCGTCTGCAGTTGAGGTGAAGGGACAGCCAAACACTGCGCTCCTTTCCACAATCATGGTTCTAGGAACTTTCCTTGTGGCATTTTATTTGAGGAAGTTTAGGACAAGTTATTTTTTTGGAAAGAAGGCCAGGAGGCTTGTAAGTGACTTTGGTATCGTCATAGCAATGGCAACGATGCTATTACTTGACATTTTCCTTCACGATAAAGTTACCACTCCAAAGATCGCCATCGGTGATCCAACCAAGAGAGGCTTTTTACCAACAAGATACACAGAGAGAGGCTGGTTTATCAACCCTGGAGGTATGACAAAAGCCATGGAGACTGGCTGGATTTTCGCGGCTATCATTCCTGCCATGTTTGTTGGAATTTTGTTATTTATGGAAACTGAACTGACTGGAGTACTTATAAACAAGAAGGAACACAAACTAACCAAAGGAGCAGGCTTCAATTTAGATTTGTGTGTTATGGGACTGCTGTCATTCATTTGTTCCTTAATGGGATTGCCGTGGATGTGCGCTGCGACTGTTCGGTCAGTCTCGCACTTGAATGCGCTGTCCATCTGGAGCACTTCGCATGCACCTGGTGTCAAACCGCACCTTATAGAAGTCAAAGAACAGAGAGTCACTAATATTGCGATACATGTCCTCACAGGGGTATCCATTCTCTTAGCACCAGCCCTCCATCTCATTCCAGTTCCAGTCATGTTTGGTGTCCTGTTATATCTTGGTGTTTGTTCGTTATCTGGTATTCAGTTGGTAGACAGACTTATCATGATGTTTATGCCACCAAAGTACCATCCTGATGTCCAGTACGTAAGAAAGGTGAAAACTAAACAGATTCATAGTTACACCATGATACAGTTGGTCTGCTTGGCTTTGCTGATTTTTATCAAGTTAACTGTTGTCGCACCGTCATTCCCGTTCTTCATTATCTGTTTAATTCCTTTGCGCAAGTCGCTGAAAAAGTTTTTTGAGGAAAATGAGCTTGAAGAGCTCGACAATGAAGAAGCACCCGATGACGACAGCGACTTGGATGAGTATGACAGTGTGTTCCTGCCAATATAAACAAGAAAGAACAGTTTAATGAATTCTTCGACGTTTGATTTACAGTGCTGCCAGTTTCCATTACAATGTTTAAATGAAATCATTTTAGTTGAGTAAAATAGCAACTTTTTGGGACCTCCTATCAGGGTGCTATAGACTTTATAAATGCAAACATTATCAGAGGTAATCCTATAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A0A096X8J7	Anion exchange protein 3 OS=Danio rerio OX=7955 GN=Slc4a3 PE=2 SV=1
P23348	Anion exchange protein 3 OS=Rattus norvegicus OX=10116 GN=Slc4a3 PE=1 SV=1
P16283	Anion exchange protein 3 OS=Mus musculus OX=10090 GN=Slc4a3 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000860 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00955 all species →	HCO3_cotransp	HCO3- transporter family	Family	Interproscan
PF07565 all species →	Band_3_cyto	Band 3 cytoplasmic domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR003020 all species →	Family	Bicarbonate transporter, eukaryotic	Interproscan
IPR011531 all species →	Domain	Bicarbonate transporter-like, transmembrane domain	Interproscan
IPR013769 all species →	Domain	Band 3 cytoplasmic domain	Interproscan
IPR016152 all species →	Homologous_superfamily	Phosphotransferase/anion transporter	Interproscan
IPR001717 all species →	Family	Anion exchange protein	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11453 all species →	ANION EXCHANGE PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005452 all species →	Molecular Function	solute:inorganic anion antiporter activity	Interproscan
GO:0006820 all species →	Biological Process	monoatomic anion transport	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0015701 all species →	Biological Process	bicarbonate transport	Interproscan
GO:0022857 all species →	Molecular Function	transmembrane transporter activity	Interproscan
GO:0050801 all species →	Biological Process	monoatomic ion homeostasis	Interproscan
GO:0055085 all species →	Biological Process	transmembrane transport	Interproscan
GO:0008509 all species →	Molecular Function	monoatomic anion transmembrane transporter activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for evm.model.Ap11.81.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of evm.model.Ap11.81 across 49 RNA-seq samples of Astrangia poculata. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

49Samples

0TPM > 0

4Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole organism · cold control	14	0	0.00	0.00
whole organism · heat control	12	0	0.00	0.00
whole organism · cold challenge	12	0	0.00	0.00
whole organism · heat challenge	11	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR10674714	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674715	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674724	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674733	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674734	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674735	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674736	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674737	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674739	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674743	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674746	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674747	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674748	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674750	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674706	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674707	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674708	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674717	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674718	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674720	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674721	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674725	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674731	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674741	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674752	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674753	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674711	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674712	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674713	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674722	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674723	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674730	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674732	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674738	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674740	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674744	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674745	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674749	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674709	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674710	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674716	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674719	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674726	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674727	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674728	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674729	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674742	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674751	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674754	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293

Source: CnidoSite RNA-seq expression matrices (APOCU_TPM, StringTie quantification over 49 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.