Gene detail

Detailed information of evm.model.Ap12.2740 in Astrangia poculata

Genomic Location: Ap12:28734185...28736770
NR annotation: XP_027047797.1, telomere length regulation protein TEL2 homolog [Pocillopora damicornis]
Species Astrangia poculata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

evm.model.Ap12.2740

atggaacaacatttggaccgagatctgcaatgtgatgttagaagatttgttcgtgaacgtcaaaacaacctggcaaatgcttctaacttgagcgaagtgattgaacccttgaatgacattgccgaactcttcttgcgaggttctctgcagcccgcgaaagtttctctggataaacgtcctgctctgaaggctgaatttgtaagcattcactttttgagatttgctgaatttatcctcacttcgccagtgatcgggttttacggtggctttaacgaagaacagaaaaaagatctttttgacgtgttttttctgcgtggtccttcgcacgacagtcttcttgtgttagggaacgcactttccaagcagtcgacgaatttgaaaaacacaaaggtggtagtctctttgctcgagaaattttgtgcagaagagagactggttgacgtgtttgtggaacaatgtcggttatccagacctttgacaagtgcgcctcaaaagttcagtcagtcagaatttgaaagtaagttgtgggaacagcttataactttgatagtctcactcccacagagagtggcaaacaaaatgagaatgaaatgcagctcacagttttacccagagccctatttcaaaatggtcgcggatcaaattctgaaagcattggagaaattgcatgacaacttaacaatgtcacatgattgttcctttaagtttcttggtgagctgattggacggatttgtatggccgggcaagcagagaaaacattttctattttgttgccagcattagagaagtggctggcgacaagtccactttggaacagaatttgtgcacgactgatcacaggtgttccggacggcaccatggaacatgtggcagaaggtctacttaaggtagctaacagtgctaccttaatagctaagctatttggtgattcagttttgtcaaacaccaaactcaagtatttactgaccactaagtttctcttgatgagaagctactccaacacaaatgttctgtacaacatcattgggtatttgtctggatgcaagcgcaggcatttgttagtggaaactatgcatacacttcttgacgtctggggtgatagaagtgccattaaacatacaacgtatgatcagcatttttatgtcacctgtgctgttgttctttcttttgggcacttaaacatagaggagaagcaatccgagaaacactttatactcacaaagttgttggttggtgtgcagagtcatttggatagtcctttggaaaaagtgcgtcgtcttgggatggtggtcgcagagtgcatcacatcatcccttgagcctaatggagagaagcttgtctttgaatatgctgaagatgatgagaccaaattattgaagtcaatggccaaaggttcacaagaaaggatggattcaggaaaagcaggaatgggaagaaagaagcttcacaacaatgtagcagaaactgaaaaagcaagaagtgacagaccttcagattctcagcttgaaactattcaaaagagcaatcctcagaaagacgaaggtgaagttgatgatgatgatgatgagttgttgccatatgatcttgatgaagatgacaatgcagggagcaagtctaactcacctaagtttctacgtgattgtattgaaggtctcgtagcatcagaagatccatctaagacagaggcttctttgaggtctgtagagaaacttgtctgtgctgatttagatgatcttgaagatgtttgtgttgagctggtaaaagtattgcttcaccttgaagaccgctattccactgataaattttatgaaatgcgtcacaatgcaatggtttctgttaccatcaggtgtcctcagcagattgcttgttacttgacagaagaattttttgctcctaactacaatttgcagcagcggatggacatgttgaatgttcttgctgatgcagcacagcagctctcagctccggcagaaatctccaaaacaagagcagtgccaagaaagtttccactccctcaagcagactcccttaaatctccacaagctgttccagactggcaaaagattgtacaagagagaattgatggcaaaacaaaaaggtttagcaaagggccatcccatccccaacccatagctgttgctaataagtttgctggtgtcgctggattcttctttttccctctgatgaaaaactttgacagcaaggtgaacactctagaccttctgggtgatgatactcttgtcctcggcaggcttgtgtacactcttggtataatcatgtactctgccagggagacgcctatagcaagaaacatgggtatggccttgtttgaatttacttgggctctgaagtatcataaagaggcatttgtacgtcaagcactgatctttgcacaggctatggctgctgtgtccattccgtcgtcgactctgatgagtgacgccccaggggaactctttgagcttcatgattggctgaagactattgttcagagtgacactgatgctgacagtgttaaggccgcttttcagacactagttttgttagaagatatttttaagaatgaagttactgtgcatggttga

Transcript

evm.model.Ap12.2740

ATGGAACAACATTTGGACCGAGATCTGCAATGTGATGTTAGAAGATTTGTTCGTGAACGTCAAAACAACCTGGCAAATGCTTCTAACTTGAGCGAAGTGATTGAACCCTTGAATGACATTGCCGAACTCTTCTTGCGAGGTTCTCTGCAGCCCGCGAAAGTTTCTCTGGATAAACGTCCTGCTCTGAAGGCTGAATTTGTAAGCATTCACTTTTTGAGATTTGCTGAATTTATCCTCACTTCGCCAGTGATCGGGTTTTACGGTGGCTTTAACGAAGAACAGAAAAAAGATCTTTTTGACGTGTTTTTTCTGCGTGGTCCTTCGCACGACAGTCTTCTTGTGTTAGGGAACGCACTTTCCAAGCAGTCGACGAATTTGAAAAACACAAAGGTGGTAGTCTCTTTGCTCGAGAAATTTTGTGCAGAAGAGAGACTGGTTGACGTGTTTGTGGAACAATGTCGGTTATCCAGACCTTTGACAAGTGCGCCTCAAAAGTTCAGTCAGTCAGAATTTGAAAGTAAGTTGTGGGAACAGCTTATAACTTTGATAGTCTCACTCCCACAGAGAGTGGCAAACAAAATGAGAATGAAATGCAGCTCACAGTTTTACCCAGAGCCCTATTTCAAAATGGTCGCGGATCAAATTCTGAAAGCATTGGAGAAATTGCATGACAACTTAACAATGTCACATGATTGTTCCTTTAAGTTTCTTGGTGAGCTGATTGGACGGATTTGTATGGCCGGGCAAGCAGAGAAAACATTTTCTATTTTGTTGCCAGCATTAGAGAAGTGGCTGGCGACAAGTCCACTTTGGAACAGAATTTGTGCACGACTGATCACAGGTGTTCCGGACGGCACCATGGAACATGTGGCAGAAGGTCTACTTAAGGTAGCTAACAGTGCTACCTTAATAGCTAAGCTATTTGGTGATTCAGTTTTGTCAAACACCAAACTCAAGTATTTACTGACCACTAAGTTTCTCTTGATGAGAAGCTACTCCAACACAAATGTTCTGTACAACATCATTGGGTATTTGTCTGGATGCAAGCGCAGGCATTTGTTAGTGGAAACTATGCATACACTTCTTGACGTCTGGGGTGATAGAAGTGCCATTAAACATACAACGTATGATCAGCATTTTTATGTCACCTGTGCTGTTGTTCTTTCTTTTGGGCACTTAAACATAGAGGAGAAGCAATCCGAGAAACACTTTATACTCACAAAGTTGTTGGTTGGTGTGCAGAGTCATTTGGATAGTCCTTTGGAAAAAGTGCGTCGTCTTGGGATGGTGGTCGCAGAGTGCATCACATCATCCCTTGAGCCTAATGGAGAGAAGCTTGTCTTTGAATATGCTGAAGATGATGAGACCAAATTATTGAAGTCAATGGCCAAAGGTTCACAAGAAAGGATGGATTCAGGAAAAGCAGGAATGGGAAGAAAGAAGCTTCACAACAATGTAGCAGAAACTGAAAAAGCAAGAAGTGACAGACCTTCAGATTCTCAGCTTGAAACTATTCAAAAGAGCAATCCTCAGAAAGACGAAGGTGAAGTTGATGATGATGATGATGAGTTGTTGCCATATGATCTTGATGAAGATGACAATGCAGGGAGCAAGTCTAACTCACCTAAGTTTCTACGTGATTGTATTGAAGGTCTCGTAGCATCAGAAGATCCATCTAAGACAGAGGCTTCTTTGAGGTCTGTAGAGAAACTTGTCTGTGCTGATTTAGATGATCTTGAAGATGTTTGTGTTGAGCTGGTAAAAGTATTGCTTCACCTTGAAGACCGCTATTCCACTGATAAATTTTATGAAATGCGTCACAATGCAATGGTTTCTGTTACCATCAGGTGTCCTCAGCAGATTGCTTGTTACTTGACAGAAGAATTTTTTGCTCCTAACTACAATTTGCAGCAGCGGATGGACATGTTGAATGTTCTTGCTGATGCAGCACAGCAGCTCTCAGCTCCGGCAGAAATCTCCAAAACAAGAGCAGTGCCAAGAAAGTTTCCACTCCCTCAAGCAGACTCCCTTAAATCTCCACAAGCTGTTCCAGACTGGCAAAAGATTGTACAAGAGAGAATTGATGGCAAAACAAAAAGGTTTAGCAAAGGGCCATCCCATCCCCAACCCATAGCTGTTGCTAATAAGTTTGCTGGTGTCGCTGGATTCTTCTTTTTCCCTCTGATGAAAAACTTTGACAGCAAGGTGAACACTCTAGACCTTCTGGGTGATGATACTCTTGTCCTCGGCAGGCTTGTGTACACTCTTGGTATAATCATGTACTCTGCCAGGGAGACGCCTATAGCAAGAAACATGGGTATGGCCTTGTTTGAATTTACTTGGGCTCTGAAGTATCATAAAGAGGCATTTGTACGTCAAGCACTGATCTTTGCACAGGCTATGGCTGCTGTGTCCATTCCGTCGTCGACTCTGATGAGTGACGCCCCAGGGGAACTCTTTGAGCTTCATGATTGGCTGAAGACTATTGTTCAGAGTGACACTGATGCTGACAGTGTTAAGGCCGCTTTTCAGACACTAGTTTTGTTAGAAGATATTTTTAAGAATGAAGTTACTGTGCATGGTTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6GPP1	Telomere length regulation protein TEL2 homolog OS=Xenopus laevis OX=8355 GN=telo2 PE=2 SV=2
Q9DC40	Telomere length regulation protein TEL2 homolog OS=Mus musculus OX=10090 GN=Telo2 PE=1 SV=2
Q08CY4	Telomere length regulation protein TEL2 homolog OS=Xenopus tropicalis OX=8364 GN=telo2 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0007513 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF10193 all species →	Telomere_reg-2	Telomere length regulation protein	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR019337 all species →	Domain	Telomere length regulation protein, conserved domain	Interproscan
IPR038528 all species →	Homologous_superfamily	TEL2, C-terminal domain superfamily	Interproscan
IPR051970 all species →	Family	Telomere Length Regulation TEL2	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR15830 all species →	TELOMERE LENGTH REGULATION PROTEIN TEL2 FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0007004 all species →	Biological Process	telomere maintenance via telomerase	Interproscan
GO:0042162 all species →	Molecular Function	telomeric DNA binding	Interproscan
GO:0050821 all species →	Biological Process	protein stabilization	Interproscan
GO:0051879 all species →	Molecular Function	Hsp90 protein binding	Interproscan
GO:0070209 all species →	Cellular Component	obsolete ASTRA complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11137	TELO2, TEL2; telomere length regulation protein	-	DNA repair and recombination proteins	ko03400	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of evm.model.Ap12.2740 across 49 RNA-seq samples of Astrangia poculata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

49Samples

2TPM > 0

4Conditions

128.5Max TPM

4.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
whole organism · cold control	14	1	6.74	94.36
whole organism · heat control	12	1	10.71	128.47
whole organism · cold challenge	12	0	0.00	0.00
whole organism · heat challenge	11	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR10674750	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	94.36
SRR10674714	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674715	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674724	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674733	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674734	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674735	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674736	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674737	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674739	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674743	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674746	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674747	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674748	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674707	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	128.47
SRR10674706	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674708	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674717	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674718	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674720	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674721	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674725	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674731	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674741	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674752	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674753	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674711	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674712	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674713	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674722	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674723	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674730	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674732	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674738	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674740	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674744	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674745	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674749	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674709	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674710	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674716	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674719	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674726	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674727	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674728	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674729	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674742	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674751	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674754	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00

Source: CnidoSite RNA-seq expression matrices (APOCU_TPM, StringTie quantification over 49 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.