Gene detail

Detailed information of evm.model.Ap13.1223 in Astrangia poculata

Genomic Location: Ap13:12645272...12669315
NR annotation: KAJ7373413.1, hypothetical protein OS493_013006 [Desmophyllum pertusum]
Species Astrangia poculata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

evm.model.Ap13.1223

atggcgacggaagatcaagaatattatggctactactatgacactgaagaagatagaggattgcttgatcccgcatgggaaagacagcaacgcaagacattcacagcgtggtgtaattctcatttaaggaaacttaatgtacagattgagaacatcgaggaggactttggcgacggtttgaaacttatgggattgttagaagtaatatcaggagaaaggctccccaaacctgagagaggacgattgcggtttcataagattgccaacgttaataaagctttagattttgtggctggcaaaggagtgaaacttgtgtcaattggtgctgaagaaatcgtggatggcaaccttaaaatgacgcttggaatgatatggacgataattctgcggtttgcaatccaagatatagctgtagaagagtcgtttgcaaaggacggcctgctactttggtgtcagcggaaaacagccccatataaaaatgtcaacgtgcagaacttccacacaagctttaaagatgggttggcgttttgtgctcttattcatcgacatcggccggaccttatcgattataactctctgagcaaggagactcccttggaaaacttgaactatgcctttgatgttgctgagaagcatttggacattccaagaatgcttgatgcagaagacatggtgaacactgccaaacctgatgaaagagctgtcatgacttatgtctcttcctactatcatgcatttacaagctcgcaaaaggctgacactgcagccaagcgtattggcaaagtacttacaattaacagaggtaatgagaagatgatggaagactacgaaaaaatggccagtgatcttcttgattggatcaacaaaactttaccgtggctcaataacagagaaagtgatgggtcactggatgatatgcagaaaaagcttgacgctcttagagtgtaccgaaggagtgaaaagcctcccagagtagaagagaaaggcatgctggagacaaattttaacaccttgcagaccaagcttcgacttggaaatcgacctgcttatctcccaacagaggggaaaatgatcagtgacatcaaccgagcctggggaaacttggaaggttcagaaaaagattttgaagattggttgttgaaagaaatgcgaagaatggaacgacttgatcacttggcagaaaaattcagacacaaatgcaatatccatgaaggttggacctctggcaaaactgacatgttaaagaaagatgattatgaaaaagctacattggcagatgtgctggccttaaagaagaagcatgaagcatttgaaagtgatctggcagctcatcaagacagagtggagcaaattgtggcaattgcccacgagcttaatgaactgggttaccgagatgttgattcagtcaacaaaagatgccagcaaatttgcgatgaatggaaagatcttgggcaactaacagaagataggcggtataaacttgagtcacgtgagacaatattgatgaagctggactccttgttgttagagtttgccaagagagcagcgctgttcaacaactggctggaaagtgcacgggaagatttaatggacatgttcagtgtgcatactgttgaagagatcacggaactgcaagatgctcaccaggtctttaaagaaaatatgccagctgcacaacaagagtttgatgctattatgagtattagtaatgaaattgagggcatgagtgaccaggaaaacccttacactagtctaactaaagaggaaatttctctgacctggagtgaagtcatagacctgattcccaagagagatgaacttcttgaaactgaaaaaggcagacagaaacgaaatgagacgcttcgtttggaatttgcacgaaaggctaatttagttggaccatggatcaatgaacacgaggagaagttacgagctattgctttgaaaatgcaaggacccctggaggaacaactgaaagctgttcaaggactggaacgagatgttgctagctacaaacctcaaatggatgaattggagctggtaaaccaggatgtacaagaagctttaatctttgaaaaccctcacacggaatacacaatggaagcacttcgagtgaactgggaacaacttttgactgccattgctagaaatattaatgaagttgaaaaccagattcttaccagggattccaagggcatctctgaagaacagatgaaggaattccgtaactcattcaacttctttgataaggatgaaaatatgcgccttgagcctcacgaatttaagcaatgcttggttagtttaggatacaatctgaaggagggagacaagggagaccaagaattcgaacgactcatggcaattgtagacccgaacaacacacgacacgtgacttttcaagcattccttgattttatgacccgagaaacggctgacacagacaccgctgagcaggtcatggactccttcaggattcttgccggggacaagccttacatcactacagaagaattgagacgtgaacttccgccagatcaagctgagtactgtattgctcgaatggcgccttatgaaggcgctgatgcagtaccaggcgctctggactacatgtccttctccactgcactatatggcgaaagcgatttgtaa

Transcript

evm.model.Ap13.1223

ATGGCGACGGAAGATCAAGAATATTATGGCTACTACTATGACACTGAAGAAGATAGAGGATTGCTTGATCCCGCATGGGAAAGACAGCAACGCAAGACATTCACAGCGTGGTGTAATTCTCATTTAAGGAAACTTAATGTACAGATTGAGAACATCGAGGAGGACTTTGGCGACGGTTTGAAACTTATGGGATTGTTAGAAGTAATATCAGGAGAAAGGCTCCCCAAACCTGAGAGAGGACGATTGCGGTTTCATAAGATTGCCAACGTTAATAAAGCTTTAGATTTTGTGGCTGGCAAAGGAGTGAAACTTGTGTCAATTGGTGCTGAAGAAATCGTGGATGGCAACCTTAAAATGACGCTTGGAATGATATGGACGATAATTCTGCGGTTTGCAATCCAAGATATAGCTGTAGAAGAGTCGTTTGCAAAGGACGGCCTGCTACTTTGGTGTCAGCGGAAAACAGCCCCATATAAAAATGTCAACGTGCAGAACTTCCACACAAGCTTTAAAGATGGGTTGGCGTTTTGTGCTCTTATTCATCGACATCGGCCGGACCTTATCGATTATAACTCTCTGAGCAAGGAGACTCCCTTGGAAAACTTGAACTATGCCTTTGATGTTGCTGAGAAGCATTTGGACATTCCAAGAATGCTTGATGCAGAAGACATGGTGAACACTGCCAAACCTGATGAAAGAGCTGTCATGACTTATGTCTCTTCCTACTATCATGCATTTACAAGCTCGCAAAAGGCTGACACTGCAGCCAAGCGTATTGGCAAAGTACTTACAATTAACAGAGGTAATGAGAAGATGATGGAAGACTACGAAAAAATGGCCAGTGATCTTCTTGATTGGATCAACAAAACTTTACCGTGGCTCAATAACAGAGAAAGTGATGGGTCACTGGATGATATGCAGAAAAAGCTTGACGCTCTTAGAGTGTACCGAAGGAGTGAAAAGCCTCCCAGAGTAGAAGAGAAAGGCATGCTGGAGACAAATTTTAACACCTTGCAGACCAAGCTTCGACTTGGAAATCGACCTGCTTATCTCCCAACAGAGGGGAAAATGATCAGTGACATCAACCGAGCCTGGGGAAACTTGGAAGGTTCAGAAAAAGATTTTGAAGATTGGTTGTTGAAAGAAATGCGAAGAATGGAACGACTTGATCACTTGGCAGAAAAATTCAGACACAAATGCAATATCCATGAAGGTTGGACCTCTGGCAAAACTGACATGTTAAAGAAAGATGATTATGAAAAAGCTACATTGGCAGATGTGCTGGCCTTAAAGAAGAAGCATGAAGCATTTGAAAGTGATCTGGCAGCTCATCAAGACAGAGTGGAGCAAATTGTGGCAATTGCCCACGAGCTTAATGAACTGGGTTACCGAGATGTTGATTCAGTCAACAAAAGATGCCAGCAAATTTGCGATGAATGGAAAGATCTTGGGCAACTAACAGAAGATAGGCGGTATAAACTTGAGTCACGTGAGACAATATTGATGAAGCTGGACTCCTTGTTGTTAGAGTTTGCCAAGAGAGCAGCGCTGTTCAACAACTGGCTGGAAAGTGCACGGGAAGATTTAATGGACATGTTCAGTGTGCATACTGTTGAAGAGATCACGGAACTGCAAGATGCTCACCAGGTCTTTAAAGAAAATATGCCAGCTGCACAACAAGAGTTTGATGCTATTATGAGTATTAGTAATGAAATTGAGGGCATGAGTGACCAGGAAAACCCTTACACTAGTCTAACTAAAGAGGAAATTTCTCTGACCTGGAGTGAAGTCATAGACCTGATTCCCAAGAGAGATGAACTTCTTGAAACTGAAAAAGGCAGACAGAAACGAAATGAGACGCTTCGTTTGGAATTTGCACGAAAGGCTAATTTAGTTGGACCATGGATCAATGAACACGAGGAGAAGTTACGAGCTATTGCTTTGAAAATGCAAGGACCCCTGGAGGAACAACTGAAAGCTGTTCAAGGACTGGAACGAGATGTTGCTAGCTACAAACCTCAAATGGATGAATTGGAGCTGGTAAACCAGGATGTACAAGAAGCTTTAATCTTTGAAAACCCTCACACGGAATACACAATGGAAGCACTTCGAGTGAACTGGGAACAACTTTTGACTGCCATTGCTAGAAATATTAATGAAGTTGAAAACCAGATTCTTACCAGGGATTCCAAGGGCATCTCTGAAGAACAGATGAAGGAATTCCGTAACTCATTCAACTTCTTTGATAAGGATGAAAATATGCGCCTTGAGCCTCACGAATTTAAGCAATGCTTGGTTAGTTTAGGATACAATCTGAAGGAGGGAGACAAGGGAGACCAAGAATTCGAACGACTCATGGCAATTGTAGACCCGAACAACACACGACACGTGACTTTTCAAGCATTCCTTGATTTTATGACCCGAGAAACGGCTGACACAGACACCGCTGAGCAGGTCATGGACTCCTTCAGGATTCTTGCCGGGGACAAGCCTTACATCACTACAGAAGAATTGAGACGTGAACTTCCGCCAGATCAAGCTGAGTACTGTATTGCTCGAATGGCGCCTTATGAAGGCGCTGATGCAGTACCAGGCGCTCTGGACTACATGTCCTTCTCCACTGCACTATATGGCGAAAGCGATTTGTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
L7UZ85	Alpha-actinin OS=Dermatophagoides farinae OX=6954 PE=1 SV=1
P05094	Alpha-actinin-1 OS=Gallus gallus OX=9031 GN=ACTN1 PE=1 SV=3
Q3B7N2	Alpha-actinin-1 OS=Bos taurus OX=9913 GN=ACTN1 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002750 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF08726 all species →	EFhand_Ca_insen	Ca2+ insensitive EF hand	Domain	Interproscan
PF00307 all species →	CH	Calponin homology (CH) domain	Domain	Interproscan
PF00435 all species →	Spectrin	Spectrin repeat	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036872 all species →	Homologous_superfamily	CH domain superfamily	Interproscan
IPR001715 all species →	Domain	Calponin homology domain	Interproscan
IPR014837 all species →	Domain	EF-hand, Ca insensitive	Interproscan
IPR002048 all species →	Domain	EF-hand domain	Interproscan
IPR018159 all species →	Repeat	Spectrin/alpha-actinin	Interproscan
IPR001589 all species →	Conserved_site	Actinin-type actin-binding domain, conserved site	Interproscan
IPR011992 all species →	Homologous_superfamily	EF-hand domain pair	Interproscan
IPR002017 all species →	Repeat	Spectrin repeat	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11915 all species →	SPECTRIN/FILAMIN RELATED CYTOSKELETAL PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005509 all species →	Molecular Function	calcium ion binding	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0030018 all species →	Cellular Component	Z disc	Interproscan
GO:0030036 all species →	Biological Process	actin cytoskeleton organization	Interproscan
GO:0030054 all species →	Cellular Component	cell junction	Interproscan
GO:0030864 all species →	Cellular Component	cortical actin cytoskeleton	Interproscan
GO:0042995 all species →	Cellular Component	cell projection	Interproscan
GO:0051015 all species →	Molecular Function	actin filament binding	Interproscan
GO:0055001 all species →	Biological Process	muscle cell development	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K05699	ACTN1_4; actinin alpha 1/4	-	Exosome	ko04147	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of evm.model.Ap13.1223 across 49 RNA-seq samples of Astrangia poculata. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

49Samples

0TPM > 0

4Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole organism · cold control	14	0	0.00	0.00
whole organism · heat control	12	0	0.00	0.00
whole organism · cold challenge	12	0	0.00	0.00
whole organism · heat challenge	11	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR10674714	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674715	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674724	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674733	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674734	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674735	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674736	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674737	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674739	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674743	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674746	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674747	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674748	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674750	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674706	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674707	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674708	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674717	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674718	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674720	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674721	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674725	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674731	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674741	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674752	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674753	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674711	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674712	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674713	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674722	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674723	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674730	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674732	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674738	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674740	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674744	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674745	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674749	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674709	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674710	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674716	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674719	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674726	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674727	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674728	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674729	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674742	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674751	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674754	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293

Source: CnidoSite RNA-seq expression matrices (APOCU_TPM, StringTie quantification over 49 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.