Gene detail

Detailed information of evm.model.Ap13.162_evm.model.Ap13.164 in Astrangia poculata

Genomic Location: Ap13:1885584...1912155
NR annotation: XP_027044959.1, poly [ADP-ribose] polymerase 1-like [Pocillopora damicornis]
Species Astrangia poculata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

evm.model.Ap13.162_evm.model.Ap13.164

atggcggacgatctgccgtacaaagctgagtatgcaaagtctaaccgtgccgcttgcaagttatgcaaggataaaatcggcaaggacagtcttagagtagcgaaaatggtccagtctcctcattttgatggaaagattcccaactggttccactacagttgtttctttaaaaagcacaaggtgaatgcttacagtgagattggtggttttgactccttgcgatgggatgatcaagagaagatcaagggcaaagtgggtgggggtgggggtgggggcaagggctcagaacctgccgcagcaaatgttgcctcagatgatttgcaggtggagtatgccaagtctaatagaagcaaatgcaagaactgtaaagagcaaattgacaagggagaacttcgtctggctaaagtcatggagcctgatgcagattccaatgcccctgcaggagtcccaattccatggtggcatcatgtagactgcttcgttgaaagccgcgagtcattaggagttgatttaactgtaacagccgagtcattctctggatttactaaactgaagaaggaagaaaaagaactgttgaagagtaaacttggatcagggggagggaaaaaggctggtaaaggaaacaagagaaaagctcaggctgtggatgaagttgatgcaaaaagaaagaagacggcagaagaagatgaggtagagaaacagctcaaggaacaaagcaaattgttgtggaaaataagagatgatttgcaaaagaattgttcgttgccagaaatccgagagatgctggaagacaatggatttagctcacagggtggagaaagttctcttctggacagatgtgctgatggaatgacatttggaagattactaccctgtacagaatgtaatgggggtcagctagtttataggacagacggctatttctgcacagggaatttaacaggttggaccaagtgcacttttgtcacaaaacagcccaagcgggacacctggaacatttctaaggagttaaaggaagaatcagactttttgaagaactttaagttcaagaaaagagagaggatattcccaaaagtgcctgatgtgcctgttgtgtcacctaaagcaatcaaatctgagactgccacttcaatggcttctcccctttctgccgctgcacctggcaaaccactttctaacatgaaatttgcagtgattggaagacttcaacaaagcaagggtaaaatcacctcagtaatagaagatcttggaggatcagttgttgagaagatgaatgcccttgttgactgctgtatcagtactcaagcggaaattgataagaaaagtaagaaaatgaaagatgctgaaaagtttgatgtaccagttgtcagtgaagactacttggaggctgtcaagaagggcggggccaaactgatgatctcacagcatagcattgcatcatgggggaataataagggtaccagtgtggtggatgctcctccatcaaaggccaaaccaaagatggagaaaagtgcttcaggaggaagggaatcagcgaagaaggtgaaggttgctgtgaaaggtggagccgcagtggatccagagtcagaaatggaagacacatgtcacgtgcttgaagaaaaaggaactgtttacagtgcaactttgggtttagttgacattgtcagaggcaccaactcttattacaaactgcaaatcttacaagctgacaagggcaattcttggcatcttttccgttcatggggaagagttgggaccacaattggaggaaccaaattggagcgttgtggatccgcaaggtcagctattgaaaagttcatggagctatatgccgaaaaaacaggaaacagctggctgaacagaaataacttggtcaagcacccaaacaagttttatccgctggaaattgactatggacaggataatgaagagctaaagacgacaattgcagcaggcagcaaatctttgcttcctactcctgtccaggaacttattaagatgatatttgatgtggagtcaatgaagaaaacactagtggaatttgaaattgacttgaagaaaatgccattgggaaagctaacaaggcggcagatagaaagtgcttactccgtgctaggagaagcacagaaattgatttctgatggtggcagtgccaatgcacttctggatgcgtcaaacaggttctattgcctgattccacatgactttggtatgaagaagccgccaatgttggataacttggagctaattcaggctaaagtgggcatgttggacaacttgcttgatattgaagttgcttacagtttgttgaagagtggggagggtgacctggccaaggatcctctggatgtcaactatgaaaaattacaaactgatctagagattcttcccaaggacagcaaggaatattcatttatcaaggactacgtgaaaaacacgcatgctgagacacatcaacaatacgagcttgaaatcttggaggttttcaaggtgaatcgtcatggggaaagagaaagatttgagcctttcaaggaacttcacaatcgccgcttgctgtggcacggctcgcgtaccacaaactacgctggcattttatctcaagggctcaggatcgcacctcctgaggccccagtgactggttatatgtttgggaaaggagtttactttgcagatatggtgtcgaagtcagcaaactactgtcggacaacacctactgataacattggtctcatgatgctgtgtgaagtcgctttaggaaacatgcatgaactaactgcggctagctacataacaaaacctccaaaaggaaagcacagtgtcaaagggtgtggtaagaccggcccagacccctcggcggatatcactttggaggatggcacgattgtccctgttggcaaaggaagtagttcaagtgctaaatatacaagcctcctctacaatgaatacatcgtgtacgatgttggccaaattaacatcaagtacctgctcaagttggattttaaatacaaatatcgatggtga

Transcript

evm.model.Ap13.162_evm.model.Ap13.164

ATGGCGGACGATCTGCCGTACAAAGCTGAGTATGCAAAGTCTAACCGTGCCGCTTGCAAGTTATGCAAGGATAAAATCGGCAAGGACAGTCTTAGAGTAGCGAAAATGGTCCAGTCTCCTCATTTTGATGGAAAGATTCCCAACTGGTTCCACTACAGTTGTTTCTTTAAAAAGCACAAGGTGAATGCTTACAGTGAGATTGGTGGTTTTGACTCCTTGCGATGGGATGATCAAGAGAAGATCAAGGGCAAAGTGGGTGGGGGTGGGGGTGGGGGCAAGGGCTCAGAACCTGCCGCAGCAAATGTTGCCTCAGATGATTTGCAGGTGGAGTATGCCAAGTCTAATAGAAGCAAATGCAAGAACTGTAAAGAGCAAATTGACAAGGGAGAACTTCGTCTGGCTAAAGTCATGGAGCCTGATGCAGATTCCAATGCCCCTGCAGGAGTCCCAATTCCATGGTGGCATCATGTAGACTGCTTCGTTGAAAGCCGCGAGTCATTAGGAGTTGATTTAACTGTAACAGCCGAGTCATTCTCTGGATTTACTAAACTGAAGAAGGAAGAAAAAGAACTGTTGAAGAGTAAACTTGGATCAGGGGGAGGGAAAAAGGCTGGTAAAGGAAACAAGAGAAAAGCTCAGGCTGTGGATGAAGTTGATGCAAAAAGAAAGAAGACGGCAGAAGAAGATGAGGTAGAGAAACAGCTCAAGGAACAAAGCAAATTGTTGTGGAAAATAAGAGATGATTTGCAAAAGAATTGTTCGTTGCCAGAAATCCGAGAGATGCTGGAAGACAATGGATTTAGCTCACAGGGTGGAGAAAGTTCTCTTCTGGACAGATGTGCTGATGGAATGACATTTGGAAGATTACTACCCTGTACAGAATGTAATGGGGGTCAGCTAGTTTATAGGACAGACGGCTATTTCTGCACAGGGAATTTAACAGGTTGGACCAAGTGCACTTTTGTCACAAAACAGCCCAAGCGGGACACCTGGAACATTTCTAAGGAGTTAAAGGAAGAATCAGACTTTTTGAAGAACTTTAAGTTCAAGAAAAGAGAGAGGATATTCCCAAAAGTGCCTGATGTGCCTGTTGTGTCACCTAAAGCAATCAAATCTGAGACTGCCACTTCAATGGCTTCTCCCCTTTCTGCCGCTGCACCTGGCAAACCACTTTCTAACATGAAATTTGCAGTGATTGGAAGACTTCAACAAAGCAAGGGTAAAATCACCTCAGTAATAGAAGATCTTGGAGGATCAGTTGTTGAGAAGATGAATGCCCTTGTTGACTGCTGTATCAGTACTCAAGCGGAAATTGATAAGAAAAGTAAGAAAATGAAAGATGCTGAAAAGTTTGATGTACCAGTTGTCAGTGAAGACTACTTGGAGGCTGTCAAGAAGGGCGGGGCCAAACTGATGATCTCACAGCATAGCATTGCATCATGGGGGAATAATAAGGGTACCAGTGTGGTGGATGCTCCTCCATCAAAGGCCAAACCAAAGATGGAGAAAAGTGCTTCAGGAGGAAGGGAATCAGCGAAGAAGGTGAAGGTTGCTGTGAAAGGTGGAGCCGCAGTGGATCCAGAGTCAGAAATGGAAGACACATGTCACGTGCTTGAAGAAAAAGGAACTGTTTACAGTGCAACTTTGGGTTTAGTTGACATTGTCAGAGGCACCAACTCTTATTACAAACTGCAAATCTTACAAGCTGACAAGGGCAATTCTTGGCATCTTTTCCGTTCATGGGGAAGAGTTGGGACCACAATTGGAGGAACCAAATTGGAGCGTTGTGGATCCGCAAGGTCAGCTATTGAAAAGTTCATGGAGCTATATGCCGAAAAAACAGGAAACAGCTGGCTGAACAGAAATAACTTGGTCAAGCACCCAAACAAGTTTTATCCGCTGGAAATTGACTATGGACAGGATAATGAAGAGCTAAAGACGACAATTGCAGCAGGCAGCAAATCTTTGCTTCCTACTCCTGTCCAGGAACTTATTAAGATGATATTTGATGTGGAGTCAATGAAGAAAACACTAGTGGAATTTGAAATTGACTTGAAGAAAATGCCATTGGGAAAGCTAACAAGGCGGCAGATAGAAAGTGCTTACTCCGTGCTAGGAGAAGCACAGAAATTGATTTCTGATGGTGGCAGTGCCAATGCACTTCTGGATGCGTCAAACAGGTTCTATTGCCTGATTCCACATGACTTTGGTATGAAGAAGCCGCCAATGTTGGATAACTTGGAGCTAATTCAGGCTAAAGTGGGCATGTTGGACAACTTGCTTGATATTGAAGTTGCTTACAGTTTGTTGAAGAGTGGGGAGGGTGACCTGGCCAAGGATCCTCTGGATGTCAACTATGAAAAATTACAAACTGATCTAGAGATTCTTCCCAAGGACAGCAAGGAATATTCATTTATCAAGGACTACGTGAAAAACACGCATGCTGAGACACATCAACAATACGAGCTTGAAATCTTGGAGGTTTTCAAGGTGAATCGTCATGGGGAAAGAGAAAGATTTGAGCCTTTCAAGGAACTTCACAATCGCCGCTTGCTGTGGCACGGCTCGCGTACCACAAACTACGCTGGCATTTTATCTCAAGGGCTCAGGATCGCACCTCCTGAGGCCCCAGTGACTGGTTATATGTTTGGGAAAGGAGTTTACTTTGCAGATATGGTGTCGAAGTCAGCAAACTACTGTCGGACAACACCTACTGATAACATTGGTCTCATGATGCTGTGTGAAGTCGCTTTAGGAAACATGCATGAACTAACTGCGGCTAGCTACATAACAAAACCTCCAAAAGGAAAGCACAGTGTCAAAGGGTGTGGTAAGACCGGCCCAGACCCCTCGGCGGATATCACTTTGGAGGATGGCACGATTGTCCCTGTTGGCAAAGGAAGTAGTTCAAGTGCTAAATATACAAGCCTCCTCTACAATGAATACATCGTGTACGATGTTGGCCAAATTAACATCAAGTACCTGCTCAAGTTGGATTTTAAATACAAATATCGATGGTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P26446	Poly [ADP-ribose] polymerase 1 OS=Gallus gallus OX=9031 GN=PARP1 PE=1 SV=2
P27008	Poly [ADP-ribose] polymerase 1 OS=Rattus norvegicus OX=10116 GN=Parp1 PE=1 SV=4
P09874	Poly [ADP-ribose] polymerase 1 OS=Homo sapiens OX=9606 GN=PARP1 PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001433 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00533 all species →	BRCT	BRCA1 C Terminus (BRCT) domain	Family	Interproscan
PF21728 all species →	PADR1_N	PADR1, N-terminal helical domain	Domain	Interproscan
PF05406 all species →	WGR	WGR domain	Domain	Interproscan
PF02877 all species →	PARP_reg	Poly(ADP-ribose) polymerase, regulatory domain	Domain	Interproscan
PF08063 all species →	PADR1_Zn_ribbon	PADR1 domain, zinc ribbon fold	Domain	Interproscan
PF00644 all species →	PARP	Poly(ADP-ribose) polymerase catalytic domain	Family	Interproscan
PF00645 all species →	zf-PARP	Poly(ADP-ribose) polymerase and DNA-Ligase Zn-finger region	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001357 all species →	Domain	BRCT domain	Interproscan
IPR008288 all species →	Family	Poly [ADP-ribose] polymerase	Interproscan
IPR049296 all species →	Domain	PARP1-like, PADR1 domain, N-terminal helical subdomain	Interproscan
IPR001510 all species →	Domain	Zinc finger, PARP-type	Interproscan
IPR036616 all species →	Homologous_superfamily	Poly(ADP-ribose) polymerase, regulatory domain superfamily	Interproscan
IPR036930 all species →	Homologous_superfamily	WGR domain superfamily	Interproscan
IPR036957 all species →	Homologous_superfamily	Zinc finger, PARP-type superfamily	Interproscan
IPR008893 all species →	Domain	WGR domain	Interproscan
IPR004102 all species →	Domain	Poly(ADP-ribose) polymerase, regulatory domain	Interproscan
IPR012982 all species →	Domain	PARP1-like, PADR1 domain, zinc ribbon fold	Interproscan
IPR036420 all species →	Homologous_superfamily	BRCT domain superfamily	Interproscan
IPR050800 all species →	Family	ADP-ribosyltransferase diphtheria toxin-like	Interproscan
IPR012317 all species →	Domain	Poly(ADP-ribose) polymerase, catalytic domain	Interproscan
IPR038650 all species →	Homologous_superfamily	PADR1, C-terminal domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10459 all species →	DNA LIGASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0003950 all species →	Molecular Function	NAD+-protein poly-ADP-ribosyltransferase activity	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0008270 all species →	Molecular Function	zinc ion binding	Interproscan
GO:0051287 all species →	Molecular Function	NAD binding	Interproscan
GO:0005730 all species →	Cellular Component	nucleolus	Interproscan
GO:0006302 all species →	Biological Process	double-strand break repair	Interproscan
GO:0070212 all species →	Biological Process	protein poly-ADP-ribosylation	Interproscan
GO:1990404 all species →	Molecular Function	NAD+-protein ADP-ribosyltransferase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K24070	PARP1; poly [ADP-ribose] polymerase 1	EC:2.4.2.30	DNA repair and recombination proteins	ko03400	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of evm.model.Ap13.162_evm.model.Ap13.164 across 49 RNA-seq samples of Astrangia poculata. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

49Samples

0TPM > 0

4Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole organism · cold control	14	0	0.00	0.00
whole organism · heat control	12	0	0.00	0.00
whole organism · cold challenge	12	0	0.00	0.00
whole organism · heat challenge	11	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR10674714	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674715	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674724	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674733	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674734	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674735	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674736	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674737	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674739	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674743	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674746	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674747	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674748	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674750	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674706	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674707	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674708	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674717	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674718	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674720	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674721	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674725	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674731	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674741	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674752	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674753	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674711	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674712	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674713	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674722	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674723	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674730	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674732	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674738	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674740	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674744	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674745	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674749	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674709	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674710	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674716	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674719	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674726	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674727	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674728	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674729	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674742	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674751	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674754	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293

Source: CnidoSite RNA-seq expression matrices (APOCU_TPM, StringTie quantification over 49 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.