Gene detail

Detailed information of evm.model.Ap13.1883 in Astrangia poculata

Genomic Location: Ap13:20220402...20222474
NR annotation: XP_020601608.1, torsin-4A-like [Orbicella faveolata]
Species Astrangia poculata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

evm.model.Ap13.1883

atgtcttcaagaccacatttccagaggaatttttcttctgcagattcttcgtggtatcgagaaagacaagaagaagagtggagtccacgaagccaagaaagcgatcatgatccgacttttgattccgacgaagagaaccacgaatcaaatgtgattgccataactgactcgagctcaagttcactcgagtcgccttttccgtgggcgaaaaactcttcattttcgcattcttcgccttcaactagccttgtgttgcgttcaaaaggtagtacggtatatcaagaaggcggtataccgacagaatcgtcgaaggaactcgttcctatgtcaagttcacttgtgatagggaagcggtctcgtgctattggccttaaagatatcgacctcacaagaaaccttgccgcgaagcatatccgagaagctaaggaagcaaacaaaagccccaagaagagccatttgttcaaccctttatcaaggcacatgtcttgcccgtcgtttagtagtcccaacgaaatcttccatacaggaccgtctgatagacatgggaagactggtaaaactggtcaaaccggttttagcagaggtttgaattttgatggcgattcacagttcagttcaccagtagttagtagctcatcgttgacaccggccagtaaatcaagcgccaatgtgttaagattatttagttgcctggacgattatgctgatgctaacatgcgaaatactccactagatgaatttgattgtgattggtgtgaaaggcgcaatcctgccacaactcggaatgctgttcagaaaagtgacaaactctgcttagtgcctacaaccaaagctatagaagttattgacttaacggccagtgatcagccgtctggtagtaaaataaacaataccggtaattacaggatccaatcagattgccagaaaagctctgagaaaaatggagatatttatgtgccaaatacagctgttcgaaatcgtttaccattgaagaaaaaagcgtctacgttgtcttttagtgatgatgaggatagtgattctacagaacatcctgtaaaaaaagacagtgagacattacaacaatcacatgctaccgatcaagagccaccaaaagagacacactctaagaagggctttaatatgaaaatgtgcatattttttgcattgtgtgcattatcgttatcattatactttcatgttaacccccatggcttttgcctagagagtgaattcagcaggaatatttcaggcattggacttgctctcaaggccgagttatatggtcaacacattgctcagaagattgtcacctctgcactgaaaaatcactttaacaagaagggcatcaagaagccacttgtaatgtcctttcatggttggactggaattggcaagaactttgttagcaatattattacggaacatttcttcaagcgcaagacccacagcccgttcgtacacaagtttatcatcccacttcatttccctcatgagtctgaggttgaaatctacaatgaacagctacagagatggattacgggaaatatatcacaatgtagaaaaggtggcttgtttatatttgacgagatggacaaaattcaccctggcatgatggacacaattaaagctgccatcttgggctaccgaggtaagaaagcagagtctggccacggaaatatggtatttatttttctgtccaattctggtggtgaggcaataaatcaacatgtactgaagcatgttcttgagggaaaattgcgagaatctctaacattaagtgaactggaaatcattttccataacatcgccaagagtatgccagacgtttggtttgcagaccttttgaaatcagaagtcattgatcacttagtcccatttcttcctttggagagaacacatgttaagcagtgtatcagaagggatctcggcaagaaagatttcctcgttaaagaggcattagttaaagagattgcagatcagatggagtacttccctgcaaaatatgaattcttttcagtatcaggttgcaagaaagtttcatccagagtagatgtagtcatgggataa

Transcript

evm.model.Ap13.1883

AATAAGATGTCTTCAAGACCACATTTCCAGAGGAATTTTTCTTCTGCAGATTCTTCGTGGTATCGAGAAAGACAAGAAGAAGAGTGGAGTCCACGAAGCCAAGAAAGCGATCATGATCCGACTTTTGATTCCGACGAAGAGAACCACGAATCAAATGTGATTGCCATAACTGACTCGAGCTCAAGTTCACTCGAGTCGCCTTTTCCGTGGGCGAAAAACTCTTCATTTTCGCATTCTTCGCCTTCAACTAGCCTTGTGTTGCGTTCAAAAGGTAGTACGGTATATCAAGAAGGCGGTATACCGACAGAATCGTCGAAGGAACTCGTTCCTATGTCAAGTTCACTTGTGATAGGGAAGCGGTCTCGTGCTATTGGCCTTAAAGATATCGACCTCACAAGAAACCTTGCCGCGAAGCATATCCGAGAAGCTAAGGAAGCAAACAAAAGCCCCAAGAAGAGCCATTTGTTCAACCCTTTATCAAGGCACATGTCTTGCCCGTCGTTTAGTAGTCCCAACGAAATCTTCCATACAGGACCGTCTGATAGACATGGGAAGACTGGTAAAACTGGTCAAACCGGTTTTAGCAGAGGTTTGAATTTTGATGGCGATTCACAGTTCAGTTCACCAGTAGTTAGTAGCTCATCGTTGACACCGGCCAGTAAATCAAGCGCCAATGTGTTAAGATTATTTAGTTGCCTGGACGATTATGCTGATGCTAACATGCGAAATACTCCACTAGATGAATTTGATTGTGATTGGTGTGAAAGGCGCAATCCTGCCACAACTCGGAATGCTGTTCAGAAAAGTGACAAACTCTGCTTAGTGCCTACAACCAAAGCTATAGAAGTTATTGACTTAACGGCCAGTGATCAGCCGTCTGGTAGTAAAATAAACAATACCGGTAATTACAGGATCCAATCAGATTGCCAGAAAAGCTCTGAGAAAAATGGAGATATTTATGTGCCAAATACAGCTGTTCGAAATCGTTTACCATTGAAGAAAAAAGCGTCTACGTTGTCTTTTAGTGATGATGAGGATAGTGATTCTACAGAACATCCTGTAAAAAAAGACAGTGAGACATTACAACAATCACATGCTACCGATCAAGAGCCACCAAAAGAGACACACTCTAAGAAGGGCTTTAATATGAAAATGTGCATATTTTTTGCATTGTGTGCATTATCGTTATCATTATACTTTCATGTTAACCCCCATGGCTTTTGCCTAGAGAGTGAATTCAGCAGGAATATTTCAGGCATTGGACTTGCTCTCAAGGCCGAGTTATATGGTCAACACATTGCTCAGAAGATTGTCACCTCTGCACTGAAAAATCACTTTAACAAGAAGGGCATCAAGAAGCCACTTGTAATGTCCTTTCATGGTTGGACTGGAATTGGCAAGAACTTTGTTAGCAATATTATTACGGAACATTTCTTCAAGCGCAAGACCCACAGCCCGTTCGTACACAAGTTTATCATCCCACTTCATTTCCCTCATGAGTCTGAGGTTGAAATCTACAATGAACAGCTACAGAGATGGATTACGGGAAATATATCACAATGTAGAAAAGGTGGCTTGTTTATATTTGACGAGATGGACAAAATTCACCCTGGCATGATGGACACAATTAAAGCTGCCATCTTGGGCTACCGAGGTAAGAAAGCAGAGTCTGGCCACGGAAATATGGTATTTATTTTTCTGTCCAATTCTGGTGGTGAGGCAATAAATCAACATGTACTGAAGCATGTTCTTGAGGGAAAATTGCGAGAATCTCTAACATTAAGTGAACTGGAAATCATTTTCCATAACATCGCCAAGAGTATGCCAGACGTTTGGTTTGCAGACCTTTTGAAATCAGAAGTCATTGATCACTTAGTCCCATTTCTTCCTTTGGAGAGAACACATGTTAAGCAGTGTATCAGAAGGGATCTCGGCAAGAAAGATTTCCTCGTTAAAGAGGCATTAGTTAAAGAGATTGCAGATCAGATGGAGTACTTCCCTGCAAAATATGAATTCTTTTCAGTATCAGGTTGCAAGAAAGTTTCATCCAGAGTAGATGTAGTCATGGGATAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9ER41	Torsin-1B OS=Mus musculus OX=10090 GN=Tor1b PE=1 SV=2
O14657	Torsin-1B OS=Homo sapiens OX=9606 GN=TOR1B PE=1 SV=2
Q60HG2	Torsin-1A OS=Macaca fascicularis OX=9541 GN=TOR1A PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001479 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF21376 all species →	TOR1A_C	Torsin-1A, C-terminal domain	Domain	Interproscan
PF06309 all species →	Torsin	Torsin	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR010448 all species →	Family	Torsin	Interproscan
IPR049337 all species →	Domain	Torsin-1A, C-terminal domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10760 all species →	TORSIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K22990	TOR1; torsin-1	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of evm.model.Ap13.1883 across 49 RNA-seq samples of Astrangia poculata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

49Samples

2TPM > 0

4Conditions

214.4Max TPM

6.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
whole organism · cold control	14	1	8.06	112.84
whole organism · heat control	12	0	0.00	0.00
whole organism · cold challenge	12	0	0.00	0.00
whole organism · heat challenge	11	1	19.49	214.38

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR10674724	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	112.84
SRR10674714	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674715	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674733	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674734	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674735	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674736	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674737	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674739	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674743	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674746	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674747	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674748	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674750	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674706	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674707	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674708	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674717	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674718	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674720	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674721	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674725	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674731	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674741	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674752	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674753	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674711	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674712	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674713	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674722	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674723	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674730	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674732	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674738	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674740	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674744	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674745	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674749	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674729	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	214.38
SRR10674709	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674710	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674716	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674719	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674726	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674727	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674728	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674742	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674751	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674754	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00

Source: CnidoSite RNA-seq expression matrices (APOCU_TPM, StringTie quantification over 49 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.