Gene detail

Detailed information of evm.model.Ap13.3159 in Astrangia poculata

Genomic Location: Ap13:33267747...33290860
NR annotation: CAH3111822.1, unnamed protein product [Porites lobata]
Species Astrangia poculata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

evm.model.Ap13.3159

atggcggcttgtgcaagttctcgccgttctcgcatgatgttaggcaaggggtatttccttgcattgcggagtacattaaaaagacttggaatactgactagatggcgacatacagaatgtgcagttgaacttgaaattgggagcaaaactatgaaattttcaacgggaaagatggccaagttagcagatggagctgttgttgctgagcatggagagaattccactttagttactgctgtaagtgagatgtcatccacagctaccaaggcaaaaggattacctttaatggttgattataaagaaaagtcagcagccgggggccagattcccaagactttcttaaggaaagacattggaacgtctgaacgagaaactctcattagtagaagaattgacagatcactgaggtcactttttcccaaaggttacttcttttctactcaggtgatgagcagtttatgggcagctgatggacttcatgatcctgatattgccgctatgaatggagcttctgcagctctggcagtttctgatattccttggagtggacctattggtgtggtgcgagttggagaggttgatggagagtttgtcatcaatccaacatggtcagaacttagcacaagcaaactaaatcttgttattgcatgcagtgaaaggaaagtagtgatggtggaagcatttgcccaagaagtgagttctgaaagattttgtgaagctcttagatttggattcaaagagtgccagcccatcatcaaagctttacatgatttgcaaagacaagctggaaaggaaaagagaacatgtccagttcttgatgctcctgtagagctggtggatgaagtcaaaagactgtcagttgagccacttgataaaatattttcgaatttcaattactcaaagatggaacgtgatagagaaatgtttgcagttagggattccgtctctgctaccattcaagagcagttccctgatgttgctgcccatctgataaatgatgttgtatttgaagtaacgagatcagtttttagaagaaatgttcttgaaaaagctcaaagatgtgatggacgtgactttgatgccctccgacccattaaatgtgaggtagatttgttcacaagccttcacggttcatctttatttcaaagaggagaaacacagatattctgtacagcaacacttggatctaatcgatctgcaagacaacctgatgctgcagtagtgggtgttggggatgtgagagaaaaactattcatgctccactatgagtttccaccattttgtgtgaatgaaataggatgggttggtggattcaatcgacgagaaattggtcatggaaacttagcagaaatggccttagagccagttgttcccaaggattttccatttgctatccgtcttacaacacaagtgttagaatcaaatggttcttcatcattagcgtcagtttgtgcaggcagtttggcactgatggatgcagggattccaatcagtcgtcctgttgcaggggcggcctgtggattgataacaagcagtgatgccgaggatccagataaactagacattgagcaatatcggctgatgacagacatcttgggcattgaggactatatgggtgatatggacttcaagcttgctggaagcagagaaggaataacagctcttcaggctgatttcaaggtcccaggcctccccctatacatagtggaggaagcagtaagaaaagcaacagatgatcggatgaaagtcttggatattattgaagaatgccaaagcgaggcgagaaaaactcccaaagaaaatgcaccagctgtcgcaaacgtgtctgttcctcgactgcaagttaaaaagctgctcggtgttggaggaatgaccatcaagaacttacaggaagaaacaggcacaaccattagtcgagttgaagaagatcagttttctgtttttgctccaaatgccaaagctctccaggaggcggtggacaagatcaatgaactgaccacagaaaaggactggtcagacgctcttcaggtcggagctacatacaccacaaaaattgttgaccttagggattatggcgtgatggtggaaatcctaccggactcacccaacgtgcttctacacacctcagaaatgtctcacggcaagattaattatccctcgaaagaatttggaataggagaaactgttgatgtcgtgtaccttggaaaggatgaacttactggacgaccacgtatttcaagaaaagcgcttttaccaaagaacaaaacacatggaaccatgaaccatgaagaatttatagcaacttacctcaaatag

Transcript

evm.model.Ap13.3159

ATGGCGGCTTGTGCAAGTTCTCGCCGTTCTCGCATGATGTTAGGCAAGGGGTATTTCCTTGCATTGCGGAGTACATTAAAAAGACTTGGAATACTGACTAGATGGCGACATACAGAATGTGCAGTTGAACTTGAAATTGGGAGCAAAACTATGAAATTTTCAACGGGAAAGATGGCCAAGTTAGCAGATGGAGCTGTTGTTGCTGAGCATGGAGAGAATTCCACTTTAGTTACTGCTGTAAGTGAGATGTCATCCACAGCTACCAAGGCAAAAGGATTACCTTTAATGGTTGATTATAAAGAAAAGTCAGCAGCCGGGGGCCAGATTCCCAAGACTTTCTTAAGGAAAGACATTGGAACGTCTGAACGAGAAACTCTCATTAGTAGAAGAATTGACAGATCACTGAGGTCACTTTTTCCCAAAGGTTACTTCTTTTCTACTCAGGTGATGAGCAGTTTATGGGCAGCTGATGGACTTCATGATCCTGATATTGCCGCTATGAATGGAGCTTCTGCAGCTCTGGCAGTTTCTGATATTCCTTGGAGTGGACCTATTGGTGTGGTGCGAGTTGGAGAGGTTGATGGAGAGTTTGTCATCAATCCAACATGGTCAGAACTTAGCACAAGCAAACTAAATCTTGTTATTGCATGCAGTGAAAGGAAAGTAGTGATGGTGGAAGCATTTGCCCAAGAAGTGAGTTCTGAAAGATTTTGTGAAGCTCTTAGATTTGGATTCAAAGAGTGCCAGCCCATCATCAAAGCTTTACATGATTTGCAAAGACAAGCTGGAAAGGAAAAGAGAACATGTCCAGTTCTTGATGCTCCTGTAGAGCTGGTGGATGAAGTCAAAAGACTGTCAGTTGAGCCACTTGATAAAATATTTTCGAATTTCAATTACTCAAAGATGGAACGTGATAGAGAAATGTTTGCAGTTAGGGATTCCGTCTCTGCTACCATTCAAGAGCAGTTCCCTGATGTTGCTGCCCATCTGATAAATGATGTTGTATTTGAAGTAACGAGATCAGTTTTTAGAAGAAATGTTCTTGAAAAAGCTCAAAGATGTGATGGACGTGACTTTGATGCCCTCCGACCCATTAAATGTGAGGTAGATTTGTTCACAAGCCTTCACGGTTCATCTTTATTTCAAAGAGGAGAAACACAGATATTCTGTACAGCAACACTTGGATCTAATCGATCTGCAAGACAACCTGATGCTGCAGTAGTGGGTGTTGGGGATGTGAGAGAAAAACTATTCATGCTCCACTATGAGTTTCCACCATTTTGTGTGAATGAAATAGGATGGGTTGGTGGATTCAATCGACGAGAAATTGGTCATGGAAACTTAGCAGAAATGGCCTTAGAGCCAGTTGTTCCCAAGGATTTTCCATTTGCTATCCGTCTTACAACACAAGTGTTAGAATCAAATGGTTCTTCATCATTAGCGTCAGTTTGTGCAGGCAGTTTGGCACTGATGGATGCAGGGATTCCAATCAGTCGTCCTGTTGCAGGGGCGGCCTGTGGATTGATAACAAGCAGTGATGCCGAGGATCCAGATAAACTAGACATTGAGCAATATCGGCTGATGACAGACATCTTGGGCATTGAGGACTATATGGGTGATATGGACTTCAAGCTTGCTGGAAGCAGAGAAGGAATAACAGCTCTTCAGGCTGATTTCAAGGTCCCAGGCCTCCCCCTATACATAGTGGAGGAAGCAGTAAGAAAAGCAACAGATGATCGGATGAAAGTCTTGGATATTATTGAAGAATGCCAAAGCGAGGCGAGAAAAACTCCCAAAGAAAATGCACCAGCTGTCGCAAACGTGTCTGTTCCTCGACTGCAAGTTAAAAAGCTGCTCGGTGTTGGAGGAATGACCATCAAGAACTTACAGGAAGAAACAGGCACAACCATTAGTCGAGTTGAAGAAGATCAGTTTTCTGTTTTTGCTCCAAATGCCAAAGCTCTCCAGGAGGCGGTGGACAAGATCAATGAACTGACCACAGAAAAGGACTGGTCAGACGCTCTTCAGGTCGGAGCTACATACACCACAAAAATTGTTGACCTTAGGGATTATGGCGTGATGGTGGAAATCCTACCGGACTCACCCAACGTGCTTCTACACACCTCAGAAATGTCTCACGGCAAGATTAATTATCCCTCGAAAGAATTTGGAATAGGAGAAACTGTTGATGTCGTGTACCTTGGAAAGGATGAACTTACTGGACGACCACGTATTTCAAGAAAAGCGCTTTTACCAAAGAACAAAACACATGGAACCATGAACCATGAAGAATTTATAGCAACTTACCTCAAATAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8TCS8	Polyribonucleotide nucleotidyltransferase 1, mitochondrial OS=Homo sapiens OX=9606 GN=PNPT1 PE=1 SV=2
Q5RCW2	Polyribonucleotide nucleotidyltransferase 1, mitochondrial OS=Pongo abelii OX=9601 GN=PNPT1 PE=2 SV=2
Q8K1R3	Polyribonucleotide nucleotidyltransferase 1, mitochondrial OS=Mus musculus OX=10090 GN=Pnpt1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004215 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00013 all species →	KH_1	KH domain	Domain	Interproscan
PF03726 all species →	PNPase	Polyribonucleotide nucleotidyltransferase, RNA binding domain	Domain	Interproscan
PF00575 all species →	S1	S1 RNA binding domain	Domain	Interproscan
PF01138 all species →	RNase_PH	3' exoribonuclease family, domain 1	Domain	Interproscan
PF03725 all species →	RNase_PH_C	3' exoribonuclease family, domain 2	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR004088 all species →	Domain	K Homology domain, type 1	Interproscan
IPR020568 all species →	Homologous_superfamily	Ribosomal protein uS5 domain 2-type superfamily	Interproscan
IPR003029 all species →	Domain	S1 domain	Interproscan
IPR036612 all species →	Homologous_superfamily	K Homology domain, type 1 superfamily	Interproscan
IPR027408 all species →	Homologous_superfamily	PNPase/RNase PH domain superfamily	Interproscan
IPR012340 all species →	Homologous_superfamily	Nucleic acid-binding, OB-fold	Interproscan
IPR015848 all species →	Domain	Polyribonucleotide nucleotidyltransferase, RNA-binding domain	Interproscan
IPR012162 all species →	Family	Polyribonucleotide nucleotidyltransferase	Interproscan
IPR001247 all species →	Domain	Exoribonuclease, phosphorolytic domain 1	Interproscan
IPR036345 all species →	Homologous_superfamily	Exoribonuclease, PH domain 2 superfamily	Interproscan
IPR015847 all species →	Domain	Exoribonuclease, phosphorolytic domain 2	Interproscan
IPR036456 all species →	Homologous_superfamily	Polyribonucleotide nucleotidyltransferase, RNA-binding domain superfamily	Interproscan
IPR004087 all species →	Domain	K Homology domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11252 all species →	POLYRIBONUCLEOTIDE NUCLEOTIDYLTRANSFERASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan
GO:0006396 all species →	Biological Process	RNA processing	Interproscan
GO:0004654 all species →	Molecular Function	polyribonucleotide nucleotidyltransferase activity	Interproscan
GO:0006402 all species →	Biological Process	mRNA catabolic process	Interproscan
GO:0000175 all species →	Molecular Function	3'-5'-RNA exonuclease activity	Interproscan
GO:0000958 all species →	Biological Process	mitochondrial mRNA catabolic process	Interproscan
GO:0000965 all species →	Biological Process	mitochondrial RNA 3'-end processing	Interproscan
GO:0005739 all species →	Cellular Component	mitochondrion	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0006401 all species →	Biological Process	RNA catabolic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K00962	pnp, PNPT1; polyribonucleotide nucleotidyltransferase	EC:2.7.7.8	Transfer RNA biogenesis	ko03016	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of evm.model.Ap13.3159 across 49 RNA-seq samples of Astrangia poculata. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

49Samples

0TPM > 0

4Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole organism · cold control	14	0	0.00	0.00
whole organism · heat control	12	0	0.00	0.00
whole organism · cold challenge	12	0	0.00	0.00
whole organism · heat challenge	11	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR10674714	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674715	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674724	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674733	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674734	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674735	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674736	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674737	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674739	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674743	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674746	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674747	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674748	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674750	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674706	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674707	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674708	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674717	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674718	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674720	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674721	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674725	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674731	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674741	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674752	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674753	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674711	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674712	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674713	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674722	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674723	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674730	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674732	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674738	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674740	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674744	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674745	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674749	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674709	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674710	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674716	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674719	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674726	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674727	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674728	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674729	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674742	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674751	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674754	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293

Source: CnidoSite RNA-seq expression matrices (APOCU_TPM, StringTie quantification over 49 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.