Gene detail

Detailed information of evm.model.Ap14.1011 in Astrangia poculata

Genomic Location: Ap14:10755873...10784026
NR annotation: XP_020600995.1, ergothioneine biosynthesis protein 1-like [Orbicella faveolata]
Species Astrangia poculata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

evm.model.Ap14.1011

atggcagtatttcagccaagcggcaaacatgttcttcattctatgaagccttgtgatctctcttcttgcacaaagagagaaatcaaggaatattttgagaactcttatgatctgtatgagacgttatttacgggtctaaaagatgagtcagcgttttataaatgccctgatcgtcttcgccttcctctgatattttactttggtcacacggcagccgtttatgtcaataaacttgtgcttgcagggctcttgaaggaaaggattaatttacactttgagacattgtttgagactggagtggacgaaatgtcttgggatgacacggagaactacaggatgggtggaagctttgtgtggccaaaggtttctgtagttgcagaataccgtaaaaaagcacgaaaggccatgttggacattattgagaacaccccactagaattacctgttactcaggaaagcaaatggtgggctgttttcatgggatttgaacatgaaaggatccactttgagacgtcatcagttctgattcgccaactgccacttgaacttgtacagaagccactaggatggaaggatggaccagctacgataggagatccggtgttgtccaatccgctgattgaaataacggagcgggctgtgagcatggggaaaccagaaaactttccatcgtacggctgggacaacgaatacggcaggtggaccgccaaggttccgcctttcaaggcttccaagtatttgattactaaccgtgaatacttggagtttgttaacgatggaggctatgaaaattgcaagtattggacacaggaaggctggcaatggaaacagttccgcaagttgcatcacccaagtttctgggtttgtggaaacaactgcaaatctggctgtggtgcggacttggcaacttactctcattgtaacctagcaaccgatgtcaatcataatggcctgcaagaaaatggcaacatgaatggccatcagaatggtgaatccaatggtgtcatgaatggccatcagaatggtgaatccaatggtgtcatgaatggccaccaccataatggcttggagtctaacggtgttacaacaaatggttactcagaggtgaaagaaagcccttacaaatatcgtgcaatgtttgaagtgatagacatgcccatggactggcctgcagaagtgaattatcacgaggctaaagcattctgtgcctggaaaggttcagattatcgtctgccgacagaggctgaacatcatgtcatgcgtggacctcagaaatctccttcagagggtacctcttgtgacatcatctaccaagataaaattgaagcgaacgtcaacatggcttatggctcatctactcctgtaaacctgtacccgccttccgaaactggtttttgtgatgtctttggaaacgtgtgggaatgggtcgaggatcatttcaatggtttttgcaaatttaaagctcatctgctgtatgatgacttttccacgccgtgctttgatggcagacacaacatgattatgggtggcagctgggtctcgactggggacgaggcatcacgattcgcccgctttgctttccgtcgccatttttttcaacatctgggttttaggattgcccagtcagttgtggacaatcccccggttcgtttggtggaaacgcctgtttttgtactgggagttggtgtagaagataaccctcctacactgcctggagtagatgacagcaatgtatatgtcagcactaccaattatcagtatcatgatgatgctgaggagtttctgtacagcgaagtcttgtcccattatggggatcttttgggagttgaaagcgatgctgatgactgtcaacagcttgcacagatgtgtcaagaagccgcccagcagtacgaatgtccagtgaagaaagccttggatgttatgtgctccgtgggtcggttctcgtatgaactcagcaagtttttggaagaggtgattgctatcgaccatagcggccgattgcttgatgcagcactcaagctgcagcaagggaagtcactggagatcaagtgtgccaatgacttgcctttggtcagtattccactgaacgagattgaagccaacgttgatcaggtgcatttccaacagtttacctggttgccgaatgagattggtatttatgacatgattatcatgtcgtgccttcaccgcctgtccaatccaaaagcctggttgattcgcctgtgggagataatcaacccgagcggcctggtgatcatcaagaccaacgtagactgggacctagagtcgctgaaagctgtgctgggaaacaagtttactctcctggagcaacgcctagttgcgagggtctgcgagggtctgcgcaaatctgacatgtgtcactcaagcgtcaccatctggcgtacaaagcattaa

Transcript

evm.model.Ap14.1011

ATGGCAGTATTTCAGCCAAGCGGCAAACATGTTCTTCATTCTATGAAGCCTTGTGATCTCTCTTCTTGCACAAAGAGAGAAATCAAGGAATATTTTGAGAACTCTTATGATCTGTATGAGACGTTATTTACGGGTCTAAAAGATGAGTCAGCGTTTTATAAATGCCCTGATCGTCTTCGCCTTCCTCTGATATTTTACTTTGGTCACACGGCAGCCGTTTATGTCAATAAACTTGTGCTTGCAGGGCTCTTGAAGGAAAGGATTAATTTACACTTTGAGACATTGTTTGAGACTGGAGTGGACGAAATGTCTTGGGATGACACGGAGAACTACAGGATGGGTGGAAGCTTTGTGTGGCCAAAGGTTTCTGTAGTTGCAGAATACCGTAAAAAAGCACGAAAGGCCATGTTGGACATTATTGAGAACACCCCACTAGAATTACCTGTTACTCAGGAAAGCAAATGGTGGGCTGTTTTCATGGGATTTGAACATGAAAGGATCCACTTTGAGACGTCATCAGTTCTGATTCGCCAACTGCCACTTGAACTTGTACAGAAGCCACTAGGATGGAAGGATGGACCAGCTACGATAGGAGATCCGGTGTTGTCCAATCCGCTGATTGAAATAACGGAGCGGGCTGTGAGCATGGGGAAACCAGAAAACTTTCCATCGTACGGCTGGGACAACGAATACGGCAGGTGGACCGCCAAGGTTCCGCCTTTCAAGGCTTCCAAGTATTTGATTACTAACCGTGAATACTTGGAGTTTGTTAACGATGGAGGCTATGAAAATTGCAAGTATTGGACACAGGAAGGCTGGCAATGGAAACAGTTCCGCAAGTTGCATCACCCAAGTTTCTGGGTTTGTGGAAACAACTGCAAATCTGGCTGTGGTGCGGACTTGGCAACTTACTCTCATTGTAACCTAGCAACCGATGTCAATCATAATGGCCTGCAAGAAAATGGCAACATGAATGGCCATCAGAATGGTGAATCCAATGGTGTCATGAATGGCCATCAGAATGGTGAATCCAATGGTGTCATGAATGGCCACCACCATAATGGCTTGGAGTCTAACGGTGTTACAACAAATGGTTACTCAGAGGTGAAAGAAAGCCCTTACAAATATCGTGCAATGTTTGAAGTGATAGACATGCCCATGGACTGGCCTGCAGAAGTGAATTATCACGAGGCTAAAGCATTCTGTGCCTGGAAAGGTTCAGATTATCGTCTGCCGACAGAGGCTGAACATCATGTCATGCGTGGACCTCAGAAATCTCCTTCAGAGGGTACCTCTTGTGACATCATCTACCAAGATAAAATTGAAGCGAACGTCAACATGGCTTATGGCTCATCTACTCCTGTAAACCTGTACCCGCCTTCCGAAACTGGTTTTTGTGATGTCTTTGGAAACGTGTGGGAATGGGTCGAGGATCATTTCAATGGTTTTTGCAAATTTAAAGCTCATCTGCTGTATGATGACTTTTCCACGCCGTGCTTTGATGGCAGACACAACATGATTATGGGTGGCAGCTGGGTCTCGACTGGGGACGAGGCATCACGATTCGCCCGCTTTGCTTTCCGTCGCCATTTTTTTCAACATCTGGGTTTTAGGATTGCCCAGTCAGTTGTGGACAATCCCCCGGTTCGTTTGGTGGAAACGCCTGTTTTTGTACTGGGAGTTGGTGTAGAAGATAACCCTCCTACACTGCCTGGAGTAGATGACAGCAATGTATATGTCAGCACTACCAATTATCAGTATCATGATGATGCTGAGGAGTTTCTGTACAGCGAAGTCTTGTCCCATTATGGGGATCTTTTGGGAGTTGAAAGCGATGCTGATGACTGTCAACAGCTTGCACAGATGTGTCAAGAAGCCGCCCAGCAGTACGAATGTCCAGTGAAGAAAGCCTTGGATGTTATGTGCTCCGTGGGTCGGTTCTCGTATGAACTCAGCAAGTTTTTGGAAGAGGTGATTGCTATCGACCATAGCGGCCGATTGCTTGATGCAGCACTCAAGCTGCAGCAAGGGAAGTCACTGGAGATCAAGTGTGCCAATGACTTGCCTTTGGTCAGTATTCCACTGAACGAGATTGAAGCCAACGTTGATCAGGTGCATTTCCAACAGTTTACCTGGTTGCCGAATGAGATTGGTATTTATGACATGATTATCATGTCGTGCCTTCACCGCCTGTCCAATCCAAAAGCCTGGTTGATTCGCCTGTGGGAGATAATCAACCCGAGCGGCCTGGTGATCATCAAGACCAACGTAGACTGGGACCTAGAGTCGCTGAAAGCTGTGCTGGGAAACAAGTTTACTCTCCTGGAGCAACGCCTAGTTGCGAGGGTCTGCGAGGGTCTGCGCAAATCTGACATGTGTCACTCAAGCGTCACCATCTGGCGTACAAAGCATTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q7D513	Hercynine oxygenase OS=Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh) OX=83331 GN=egtB PE=2 SV=1
O69671	Hercynine oxygenase OS=Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) OX=83332 GN=egtB PE=1 SV=1
A0R5N0	Hercynine oxygenase OS=Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155) OX=246196 GN=egtB PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002410 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03781 all species →	FGE-sulfatase	Sulfatase-modifying factor enzyme 1	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR027577 all species →	Family	5-histidylcysteine sulfoxide synthase	Interproscan
IPR016187 all species →	Homologous_superfamily	C-type lectin fold	Interproscan
IPR029063 all species →	Homologous_superfamily	S-adenosyl-L-methionine-dependent methyltransferase superfamily	Interproscan
IPR051043 all species →	Family	Sulfatase Modifying Factor and Kinase	Interproscan
IPR005532 all species →	Domain	Sulfatase-modifying factor enzyme	Interproscan
IPR042095 all species →	Homologous_superfamily	Sulfatase-modifying factor enzyme superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23150 all species →	SULFATASE MODIFYING FACTOR 1, 2	Interproscan

Gene Ontology

No Gene Ontology signature was recorded for evm.model.Ap14.1011 in Astrangia poculata.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for evm.model.Ap14.1011.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of evm.model.Ap14.1011 across 49 RNA-seq samples of Astrangia poculata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

49Samples

1TPM > 0

4Conditions

756.8Max TPM

15.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
whole organism · cold control	14	0	0.00	0.00
whole organism · heat control	12	1	63.07	756.82
whole organism · cold challenge	12	0	0.00	0.00
whole organism · heat challenge	11	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR10674714	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674715	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674724	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674733	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674734	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674735	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674736	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674737	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674739	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674743	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674746	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674747	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674748	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674750	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674741	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	756.82
SRR10674706	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674707	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674708	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674717	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674718	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674720	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674721	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674725	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674731	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674752	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674753	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674711	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674712	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674713	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674722	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674723	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674730	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674732	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674738	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674740	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674744	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674745	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674749	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674709	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674710	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674716	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674719	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674726	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674727	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674728	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674729	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674742	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674751	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674754	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00

Source: CnidoSite RNA-seq expression matrices (APOCU_TPM, StringTie quantification over 49 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.