Gene detail

Detailed information of evm.model.Ap14.1278.1.5f15ddfe in Astrangia poculata

Genomic Location: Ap14:13652461...13697008
NR annotation: KAJ7386309.1, hypothetical protein OS493_010716 [Desmophyllum pertusum]
Species Astrangia poculata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

evm.model.Ap14.1278.1.5f15ddfe

atggcgttgtcgaaacactcctcggatattgagaacctgcttgcacttaacccaaagataaagccacatgcaagcttagtttctacttcaacgacaaaaaccaacagaaaattatggaagagaaatctggaaaagggctgttctagttgtgaaagtcttgtaaacgactttgatgatgtcaagcacacaacactgagtgagagggcagccttaagggaggctgcaaggtgtcttaagtgtgctgatgcaccttgtcagaagagctgcccaacacagctagacattaaatccttcatcactagcattgccaacaagaactattatggagctgccaaagcaatctttagtgacaatcctgttggtttaacatgtggtatggtatgccctacaagtgacctttgtgttggtggttgtaatttgtatgcctcagaggagggacctattaacattggcggcttacaacagtttgccacagagattttcaagagtatgaggattgaacaaatacgtgacccctcactagtacctgttgatcagcttcctgagagttaccataccaaggtggcactacttggatgtggtccagcgtctatcagctgtgctacatttttggctcgtctgggttacactaacgtgacaatatttgaaaaggaaaattactttggtggcttaagctcctcagagattccacagtacaggcttccatatgatgcagttagttttgaagtggaacttatgaaggaccttggagtaaagattgaacatggtaaaggtttgggcaaagatggactttcaattaaatttctcagagaaaaaggatttgagagcattttcattggtattggtctgccacagcccaaacttgcttcagtatttgatgggttaaatgttgcaaatggtttctacacttccaaagattttttgcccatagtatccatgggaagcaaggcaggtatgtgttcctgtaagacaaagttaccagaactgtttggaaacgtcatcgtccttggatgtggagacactgcctttgactgttgcacatcagctcttcgttgtggagctcgtaaagtgtttgtcatatttagaaaaggcttcactaacattagagctgttccagaagagatgcagttggcagttgaagagaagtgcgagttcttgccttttctttcaccaaaaaaggtccatgttaaagatggaaaaatttctgcattggagttctacaagacggaacagctggaggatggcacatggattgaagatgaagaacagacgctaaaaataaaggcaaactttgtcatttcagcttttggttccacacttagcgacggtgatgtcatcaaggccatggcacctttaaagtttaacaagtggggtcttcctgaagtggatccaaccacaatgagcagcagtgaaccaggcgtgttttgtggaggggaccttgctggagtagccaacactacagtggagagtgtcaatgatggcaagcaagctgcctggcacatgcacaagtatttacaggcacttcatggtgtgcctgtggccaatgagccaagccttccaaagttctacacacatgttgatgaggtggacctgagtgtagacatctgtgggttaaaatttgacaatccatttggtttagctagtgctccacccaccactagtgcagctatgatcagacgaggatttcaagctggctgggggtttgctgtaaccaaaacattttcacttgacaaggacattgtgacaaatgtgtctcctcgtattgtacgtggaacaacgtcaggtcacttatttggcccgggtcaaggagctttccttaacatagaactcatcagtgaaaagacagcagcatattggtgtcgttctgttacagagattaagaaagattttccagacaagattgtaattgctagcataatgtgtggttattccaaggaagattggactgaactggctcggatggctgagaattcaggtgctgatgctttggagttaaacttatcgtgcccacatggaatgggagagagaggaatgggcttagcttgtggccaggatcctgaactggtccgtaacatttgccggtgggtgcgaagtgccattaaaataccattttttgccaagttaactcctaatgtcacagacattgtcaacattgcaagagctgcgaaggaaggctgtgctgatggtgtcactgcaaccaacacagtgtctggcttgatgggcctgcggccaagtggtgctgcatggccagcagttggaaacgaacaaaggacaacatatggtggagtgtctgggaatgcaattcgccccattgcattgcgagctgtatctgcaattggaagagctctacctgggtttccaatcctggccactggtggagttgacagcgctgaagcagcattacagtttcttcattgtggagcatctgctgttcaggtatcaagtgctgtacagaaccaggacttcactctgattgatgattataccacaggattaaagtgtttgctgtaccttcaaactattgatgaacttgtagcttggagtggtcagagtcctcctacaccaaagcaccaaaaaggaaaaattgttcctaaaatagctgaacttgttggaaaggtatgccatacatatattgacattttcacatactcgtgtttttctgtaataaacggatga

Transcript

evm.model.Ap14.1278.1.5f15ddfe

ATGGCGTTGTCGAAACACTCCTCGGATATTGAGAACCTGCTTGCACTTAACCCAAAGATAAAGCCACATGCAAGCTTAGTTTCTACTTCAACGACAAAAACCAACAGAAAATTATGGAAGAGAAATCTGGAAAAGGGCTGTTCTAGTTGTGAAAGTCTTGTAAACGACTTTGATGATGTCAAGCACACAACACTGAGTGAGAGGGCAGCCTTAAGGGAGGCTGCAAGGTGTCTTAAGTGTGCTGATGCACCTTGTCAGAAGAGCTGCCCAACACAGCTAGACATTAAATCCTTCATCACTAGCATTGCCAACAAGAACTATTATGGAGCTGCCAAAGCAATCTTTAGTGACAATCCTGTTGGTTTAACATGTGGTATGGTATGCCCTACAAGTGACCTTTGTGTTGGTGGTTGTAATTTGTATGCCTCAGAGGAGGGACCTATTAACATTGGCGGCTTACAACAGTTTGCCACAGAGATTTTCAAGAGTATGAGGATTGAACAAATACGTGACCCCTCACTAGTACCTGTTGATCAGCTTCCTGAGAGTTACCATACCAAGGTGGCACTACTTGGATGTGGTCCAGCGTCTATCAGCTGTGCTACATTTTTGGCTCGTCTGGGTTACACTAACGTGACAATATTTGAAAAGGAAAATTACTTTGGTGGCTTAAGCTCCTCAGAGATTCCACAGTACAGGCTTCCATATGATGCAGTTAGTTTTGAAGTGGAACTTATGAAGGACCTTGGAGTAAAGATTGAACATGGTAAAGGTTTGGGCAAAGATGGACTTTCAATTAAATTTCTCAGAGAAAAAGGATTTGAGAGCATTTTCATTGGTATTGGTCTGCCACAGCCCAAACTTGCTTCAGTATTTGATGGGTTAAATGTTGCAAATGGTTTCTACACTTCCAAAGATTTTTTGCCCATAGTATCCATGGGAAGCAAGGCAGGTATGTGTTCCTGTAAGACAAAGTTACCAGAACTGTTTGGAAACGTCATCGTCCTTGGATGTGGAGACACTGCCTTTGACTGTTGCACATCAGCTCTTCGTTGTGGAGCTCGTAAAGTGTTTGTCATATTTAGAAAAGGCTTCACTAACATTAGAGCTGTTCCAGAAGAGATGCAGTTGGCAGTTGAAGAGAAGTGCGAGTTCTTGCCTTTTCTTTCACCAAAAAAGGTCCATGTTAAAGATGGAAAAATTTCTGCATTGGAGTTCTACAAGACGGAACAGCTGGAGGATGGCACATGGATTGAAGATGAAGAACAGACGCTAAAAATAAAGGCAAACTTTGTCATTTCAGCTTTTGGTTCCACACTTAGCGACGGTGATGTCATCAAGGCCATGGCACCTTTAAAGTTTAACAAGTGGGGTCTTCCTGAAGTGGATCCAACCACAATGAGCAGCAGTGAACCAGGCGTGTTTTGTGGAGGGGACCTTGCTGGAGTAGCCAACACTACAGTGGAGAGTGTCAATGATGGCAAGCAAGCTGCCTGGCACATGCACAAGTATTTACAGGCACTTCATGGTGTGCCTGTGGCCAATGAGCCAAGCCTTCCAAAGTTCTACACACATGTTGATGAGGTGGACCTGAGTGTAGACATCTGTGGGTTAAAATTTGACAATCCATTTGGTTTAGCTAGTGCTCCACCCACCACTAGTGCAGCTATGATCAGACGAGGATTTCAAGCTGGCTGGGGGTTTGCTGTAACCAAAACATTTTCACTTGACAAGGACATTGTGACAAATGTGTCTCCTCGTATTGTACGTGGAACAACGTCAGGTCACTTATTTGGCCCGGGTCAAGGAGCTTTCCTTAACATAGAACTCATCAGTGAAAAGACAGCAGCATATTGGTGTCGTTCTGTTACAGAGATTAAGAAAGATTTTCCAGACAAGATTGTAATTGCTAGCATAATGTGTGGTTATTCCAAGGAAGATTGGACTGAACTGGCTCGGATGGCTGAGAATTCAGGTGCTGATGCTTTGGAGTTAAACTTATCGTGCCCACATGGAATGGGAGAGAGAGGAATGGGCTTAGCTTGTGGCCAGGATCCTGAACTGGTCCGTAACATTTGCCGGTGGGTGCGAAGTGCCATTAAAATACCATTTTTTGCCAAGTTAACTCCTAATGTCACAGACATTGTCAACATTGCAAGAGCTGCGAAGGAAGGCTGTGCTGATGGTGTCACTGCAACCAACACAGTGTCTGGCTTGATGGGCCTGCGGCCAAGTGGTGCTGCATGGCCAGCAGTTGGAAACGAACAAAGGACAACATATGGTGGAGTGTCTGGGAATGCAATTCGCCCCATTGCATTGCGAGCTGTATCTGCAATTGGAAGAGCTCTACCTGGGTTTCCAATCCTGGCCACTGGTGGAGTTGACAGCGCTGAAGCAGCATTACAGTTTCTTCATTGTGGAGCATCTGCTGTTCAGGTATCAAGTGCTGTACAGAACCAGGACTTCACTCTGATTGATGATTATACCACAGGATTAAAGTGTTTGCTGTACCTTCAAACTATTGATGAACTTGTAGCTTGGAGTGGTCAGAGTCCTCCTACACCAAAGCACCAAAAAGGAAAAATTGTTCCTAAAATAGCTGAACTTGTTGGAAAGGTATGCCATACATATATTGACATTTTCACATACTCGTGTTTTTCTGTAATAAACGGATGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6NYG8	Dihydropyrimidine dehydrogenase [NADP(+)] OS=Danio rerio OX=7955 GN=dpyd PE=2 SV=1
Q8CHR6	Dihydropyrimidine dehydrogenase [NADP(+)] OS=Mus musculus OX=10090 GN=Dpyd PE=1 SV=1
O89000	Dihydropyrimidine dehydrogenase [NADP(+)] OS=Rattus norvegicus OX=10116 GN=Dpyd PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003103 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF14691 all species →	Fer4_20	Dihydroprymidine dehydrogenase domain II, 4Fe-4S cluster	Domain	Interproscan
PF07992 all species →	Pyr_redox_2	Pyridine nucleotide-disulphide oxidoreductase	Domain	Interproscan
PF01180 all species →	DHO_dh	Dihydroorotate dehydrogenase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013785 all species →	Homologous_superfamily	Aldolase-type TIM barrel	Interproscan
IPR001295 all species →	Conserved_site	Dihydroorotate dehydrogenase, conserved site	Interproscan
IPR036188 all species →	Homologous_superfamily	FAD/NAD(P)-binding domain superfamily	Interproscan
IPR028261 all species →	Domain	Dihydroprymidine dehydrogenase domain II	Interproscan
IPR009051 all species →	Homologous_superfamily	Alpha-helical ferredoxin	Interproscan
IPR023753 all species →	Domain	FAD/NAD(P)-binding domain	Interproscan
IPR005720 all species →	Domain	Dihydroorotate dehydrogenase, catalytic	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR43073 all species →	DIHYDROPYRIMIDINE DEHYDROGENASE [NADP(+)]	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006207 all species →	Biological Process	'de novo' pyrimidine nucleobase biosynthetic process	Interproscan
GO:0016627 all species →	Molecular Function	oxidoreductase activity, acting on the CH-CH group of donors	Interproscan
GO:0051536 all species →	Molecular Function	iron-sulfur cluster binding	Interproscan
GO:0016491 all species →	Molecular Function	oxidoreductase activity	Interproscan
GO:0002058 all species →	Molecular Function	uracil binding	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0006210 all species →	Biological Process	thymine catabolic process	Interproscan
GO:0006212 all species →	Biological Process	uracil catabolic process	Interproscan
GO:0017113 all species →	Molecular Function	dihydropyrimidine dehydrogenase (NADP+) activity	Interproscan
GO:0050661 all species →	Molecular Function	NADP binding	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K00207	DPYD; dihydropyrimidine dehydrogenase (NADP+)	EC:1.3.1.2	Drug metabolism - other enzymes	ko00983	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of evm.model.Ap14.1278.1.5f15ddfe across 49 RNA-seq samples of Astrangia poculata. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

49Samples

0TPM > 0

4Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole organism · cold control	14	0	0.00	0.00
whole organism · heat control	12	0	0.00	0.00
whole organism · cold challenge	12	0	0.00	0.00
whole organism · heat challenge	11	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR10674714	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674715	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674724	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674733	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674734	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674735	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674736	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674737	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674739	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674743	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674746	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674747	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674748	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674750	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674706	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674707	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674708	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674717	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674718	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674720	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674721	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674725	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674731	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674741	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674752	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674753	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674711	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674712	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674713	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674722	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674723	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674730	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674732	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674738	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674740	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674744	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674745	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674749	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674709	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674710	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674716	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674719	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674726	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674727	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674728	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674729	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674742	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674751	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674754	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293

Source: CnidoSite RNA-seq expression matrices (APOCU_TPM, StringTie quantification over 49 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.