Gene detail

Detailed information of evm.model.Ap14.345.1.5f15dc1b in Astrangia poculata

Genomic Location: Ap14:3549412...3570203
NR annotation: XP_020625708.1, leucine-rich repeat-containing protein 7-like [Orbicella faveolata]
Species Astrangia poculata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

evm.model.Ap14.345.1.5f15dc1b

atgaggcgatggggcggtctaaagagttgtttctctgtcgagtgcgagggcaacggtgatatggctgtgttggatctgcggcattgcaacctatcttcagtgccaacagacgtctttaaggctgagccaaacttggaagaaatttatctggacgctaatcagattagagaattaccaagggcgttgtttgggttgcagagcctgcatgtccttggtttgagtgataatgaattaactgtgttaccctcagctgtttcgaacttgacaaacttgagagaagtcgacatcagcaagaatggtataattgatttgccagagagtgtgaaaaactgcaaatgtctggaacaatttgaagcaagcgtgaatcccatcggaaaaattccagatgggtttacgcagttgttaaatttgacacatgtctatttgaatgatgcttttttggatcgtttgccgtcaaattttggaaggttatcaaagctaaaagtccttgaactgagagagaaccacttacgctccctaccagaatctatgtcatattttacacaactagaaagacttgatattggaaacaatgaatttgttgaactgccaacagttgttgggtgtttagtgaaccttaaagaactttggatggacaataatggcgtcagagaacttccaccggtaataggactactgcgacagcttttgtttcttgatgtttccaaaaacagactggagcgtcttccgccagaaatagaaagtctgcagtccctaactgatctttatttatccaacaatctgttacttgagttactagataacattggttcccttggaaatttacaaacactcaaagttgatgagaatcaccttatagaactgccaggcagtatagggagattgaccaatctggaagaactggttgtaaatcacaatgaattagagagtttaccatcttctattggattcttgaggaaattacgcatcttatatgctgatgaaaactttttggaggcgattccattggagttaggtagctgttcatcaatgacaatactatcattacgcgacaacaggattgtgagaattcctgatgatattggtcggatgccaaaccttcaggtgatgaaccttgcttgcaacagattagaatgtctaccatatacattcagaaagctgactagtttaaaagctctatggctctcagaaaaccagtccaaaccaatggttcctcttcaatctgattttgatcatggaactcagtcacatgtgttgacttgctttatgtttccacaacagcctcctgttgacgaagtttcttcagtttctgaacaacaaagtgaagactcagcaggcagcattccagcgtctcttcttgaagaacagctcaggcaaagatcttctatcgtgttcaacattgatgaagatgactatctgtcgcggttagccagataccagtcaccttacccaaaagatgtaaaggatcgcgcaacgcagtatcttgcgagcagacggcagcaacaacaggagatagaggtaacccatcctgtattaccgtcacagcaccagtgtcatcaacaacaacggcaccagtatagataccagcacagaaaacagcactcgtctccagaatcaaccagtgcacaaaaccagcaaccagccagtcaacagcaacctgtggcagtagtggtacagtcagtagagcgcagtcagcagccgcagctgctaagaccacaagagcttccaactccgactcaaaccacagagcaaagacgaactcagccagtcgtcgttgtccacccactgaacagcactcaacgggtgataccaaatggtattgcccagcgaggtaatacggggagagtcacagctaatcaaaacacggaaccacagacgtcggtgagaggagctcaggccacagtgagaagtatacaaggagaccggcttattgggggacaagctgctactcaagaggaaccgccctctcgcactccgcctgtatatcaacctcccccaccctacaccccgcgaggaaacagaatcgcttctcccccaccccctgaaggtgaccgtagaacatctgtggaaacccaacattcatttcgcgaagaagtgcccagctctttgtcttcgtatcatggacgtccaggtgcccgactgtggagcagttccacagggacaccagacacaggacaattaggcgaaatgcattcatttaatgagcaggaacctagttttcttcaaggtcctttaaggccaccgtcatattacgaagctacaaaccaatctgacagagtacctattgggactgctgtacctcgcatcattcatgcgtcacaaagtgtccctaatgcagttctcacgaatggaactaacattagccaaagatcgcccccaccccagtactcagtacaaccggaagtttttgctgaacttccggtgcgccaggttttaccggaaccggaagtgccttcaagtgctggcgcgcaatcagttgtaccggttataaatagttcacaaagacttgatatttcacaagaagacgcacagagatttgagagtagagttcgacagattcaacaggagagagcactggaacatagagaagtaactgttgatggaccgcgggcaaacgttggagataatcggaggcctcaagagattgcgccgtcgattccacgcgttcttcgcaggagtaattcgtcagaatctcgcaattctgaacaatctgtgcaatcatcgcaagacgatgatgaacctgtggacaatgacccgaacatagaactgcttcacgtggaggtttacaagaatcccaatcttggtttcagtgtaggtggtggagttggctcgtcgtcgaatccttttaatccgaacgacaacaagagtatatatgtgaccaaagttcaacccgatggaccagcatcttttggacttatacctggagacaggattctagaggttaatggaatcaacctaagacgcgtgactcacgagaaagctgtactgtttctaaaacacaaccaagtcgtcaatctactcattgcaagaaacaaagagcaaccatcttga

Transcript

evm.model.Ap14.345.1.5f15dc1b

ATGAGGCGATGGGGCGGTCTAAAGAGTTGTTTCTCTGTCGAGTGCGAGGGCAACGGTGATATGGCTGTGTTGGATCTGCGGCATTGCAACCTATCTTCAGTGCCAACAGACGTCTTTAAGGCTGAGCCAAACTTGGAAGAAATTTATCTGGACGCTAATCAGATTAGAGAATTACCAAGGGCGTTGTTTGGGTTGCAGAGCCTGCATGTCCTTGGTTTGAGTGATAATGAATTAACTGTGTTACCCTCAGCTGTTTCGAACTTGACAAACTTGAGAGAAGTCGACATCAGCAAGAATGGTATAATTGATTTGCCAGAGAGTGTGAAAAACTGCAAATGTCTGGAACAATTTGAAGCAAGCGTGAATCCCATCGGAAAAATTCCAGATGGGTTTACGCAGTTGTTAAATTTGACACATGTCTATTTGAATGATGCTTTTTTGGATCGTTTGCCGTCAAATTTTGGAAGGTTATCAAAGCTAAAAGTCCTTGAACTGAGAGAGAACCACTTACGCTCCCTACCAGAATCTATGTCATATTTTACACAACTAGAAAGACTTGATATTGGAAACAATGAATTTGTTGAACTGCCAACAGTTGTTGGGTGTTTAGTGAACCTTAAAGAACTTTGGATGGACAATAATGGCGTCAGAGAACTTCCACCGGTAATAGGACTACTGCGACAGCTTTTGTTTCTTGATGTTTCCAAAAACAGACTGGAGCGTCTTCCGCCAGAAATAGAAAGTCTGCAGTCCCTAACTGATCTTTATTTATCCAACAATCTGTTACTTGAGTTACTAGATAACATTGGTTCCCTTGGAAATTTACAAACACTCAAAGTTGATGAGAATCACCTTATAGAACTGCCAGGCAGTATAGGGAGATTGACCAATCTGGAAGAACTGGTTGTAAATCACAATGAATTAGAGAGTTTACCATCTTCTATTGGATTCTTGAGGAAATTACGCATCTTATATGCTGATGAAAACTTTTTGGAGGCGATTCCATTGGAGTTAGGTAGCTGTTCATCAATGACAATACTATCATTACGCGACAACAGGATTGTGAGAATTCCTGATGATATTGGTCGGATGCCAAACCTTCAGGTGATGAACCTTGCTTGCAACAGATTAGAATGTCTACCATATACATTCAGAAAGCTGACTAGTTTAAAAGCTCTATGGCTCTCAGAAAACCAGTCCAAACCAATGGTTCCTCTTCAATCTGATTTTGATCATGGAACTCAGTCACATGTGTTGACTTGCTTTATGTTTCCACAACAGCCTCCTGTTGACGAAGTTTCTTCAGTTTCTGAACAACAAAGTGAAGACTCAGCAGGCAGCATTCCAGCGTCTCTTCTTGAAGAACAGCTCAGGCAAAGATCTTCTATCGTGTTCAACATTGATGAAGATGACTATCTGTCGCGGTTAGCCAGATACCAGTCACCTTACCCAAAAGATGTAAAGGATCGCGCAACGCAGTATCTTGCGAGCAGACGGCAGCAACAACAGGAGATAGAGGTAACCCATCCTGTATTACCGTCACAGCACCAGTGTCATCAACAACAACGGCACCAGTATAGATACCAGCACAGAAAACAGCACTCGTCTCCAGAATCAACCAGTGCACAAAACCAGCAACCAGCCAGTCAACAGCAACCTGTGGCAGTAGTGGTACAGTCAGTAGAGCGCAGTCAGCAGCCGCAGCTGCTAAGACCACAAGAGCTTCCAACTCCGACTCAAACCACAGAGCAAAGACGAACTCAGCCAGTCGTCGTTGTCCACCCACTGAACAGCACTCAACGGGTGATACCAAATGGTATTGCCCAGCGAGGTAATACGGGGAGAGTCACAGCTAATCAAAACACGGAACCACAGACGTCGGTGAGAGGAGCTCAGGCCACAGTGAGAAGTATACAAGGAGACCGGCTTATTGGGGGACAAGCTGCTACTCAAGAGGAACCGCCCTCTCGCACTCCGCCTGTATATCAACCTCCCCCACCCTACACCCCGCGAGGAAACAGAATCGCTTCTCCCCCACCCCCTGAAGGTGACCGTAGAACATCTGTGGAAACCCAACATTCATTTCGCGAAGAAGTGCCCAGCTCTTTGTCTTCGTATCATGGACGTCCAGGTGCCCGACTGTGGAGCAGTTCCACAGGGACACCAGACACAGGACAATTAGGCGAAATGCATTCATTTAATGAGCAGGAACCTAGTTTTCTTCAAGGTCCTTTAAGGCCACCGTCATATTACGAAGCTACAAACCAATCTGACAGAGTACCTATTGGGACTGCTGTACCTCGCATCATTCATGCGTCACAAAGTGTCCCTAATGCAGTTCTCACGAATGGAACTAACATTAGCCAAAGATCGCCCCCACCCCAGTACTCAGTACAACCGGAAGTTTTTGCTGAACTTCCGGTGCGCCAGGTTTTACCGGAACCGGAAGTGCCTTCAAGTGCTGGCGCGCAATCAGTTGTACCGGTTATAAATAGTTCACAAAGACTTGATATTTCACAAGAAGACGCACAGAGATTTGAGAGTAGAGTTCGACAGATTCAACAGGAGAGAGCACTGGAACATAGAGAAGTAACTGTTGATGGACCGCGGGCAAACGTTGGAGATAATCGGAGGCCTCAAGAGATTGCGCCGTCGATTCCACGCGTTCTTCGCAGGAGTAATTCGTCAGAATCTCGCAATTCTGAACAATCTGTGCAATCATCGCAAGACGATGATGAACCTGTGGACAATGACCCGAACATAGAACTGCTTCACGTGGAGGTTTACAAGAATCCCAATCTTGGTTTCAGTGTAGGTGGTGGAGTTGGCTCGTCGTCGAATCCTTTTAATCCGAACGACAACAAGAGTATATATGTGACCAAAGTTCAACCCGATGGACCAGCATCTTTTGGACTTATACCTGGAGACAGGATTCTAGAGGTTAATGGAATCAACCTAAGACGCGTGACTCACGAGAAAGCTGTACTGTTTCTAAAACACAACCAAGTCGTCAATCTACTCATTGCAAGAAACAAAGAGCAACCATCTTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q80TE7	Leucine-rich repeat-containing protein 7 OS=Mus musculus OX=10090 GN=Lrrc7 PE=1 SV=2
P70587	Leucine-rich repeat-containing protein 7 OS=Rattus norvegicus OX=10116 GN=Lrrc7 PE=1 SV=2
F1MCA7	Leucine-rich repeat-containing protein 7 OS=Bos taurus OX=9913 GN=LRRC7 PE=3 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003258 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13855 all species →	LRR_8	Leucine rich repeat	Repeat	Interproscan
PF00595 all species →	PDZ	PDZ domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001478 all species →	Domain	PDZ domain	Interproscan
IPR036034 all species →	Homologous_superfamily	PDZ superfamily	Interproscan
IPR050614 all species →	Family	Synaptic Scaffolding LAP/MAGUK Families	Interproscan
IPR032675 all species →	Homologous_superfamily	Leucine-rich repeat domain superfamily	Interproscan
IPR001611 all species →	Repeat	Leucine-rich repeat	Interproscan
IPR003591 all species →	Repeat	Leucine-rich repeat, typical subtype	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23119 all species →	DISCS LARGE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005912 all species →	Cellular Component	adherens junction	Interproscan
GO:0009790 all species →	Biological Process	embryo development	Interproscan
GO:0014069 all species →	Cellular Component	postsynaptic density	Interproscan
GO:0016323 all species →	Cellular Component	basolateral plasma membrane	Interproscan
GO:0030054 all species →	Cellular Component	cell junction	Interproscan
GO:0043113 all species →	Biological Process	receptor clustering	Interproscan
GO:0045197 all species →	Biological Process	establishment or maintenance of epithelial cell apical/basal polarity	Interproscan
GO:0045211 all species →	Cellular Component	postsynaptic membrane	Interproscan
GO:0097120 all species →	Biological Process	receptor localization to synapse	Interproscan
GO:0098609 all species →	Biological Process	cell-cell adhesion	Interproscan
GO:0098887 all species →	Biological Process	neurotransmitter receptor transport, endosome to postsynaptic membrane	Interproscan
GO:0098968 all species →	Biological Process	neurotransmitter receptor transport postsynaptic membrane to endosome	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for evm.model.Ap14.345.1.5f15dc1b.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of evm.model.Ap14.345.1.5f15dc1b across 49 RNA-seq samples of Astrangia poculata. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

49Samples

0TPM > 0

4Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole organism · cold control	14	0	0.00	0.00
whole organism · heat control	12	0	0.00	0.00
whole organism · cold challenge	12	0	0.00	0.00
whole organism · heat challenge	11	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR10674714	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674715	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674724	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674733	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674734	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674735	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674736	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674737	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674739	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674743	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674746	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674747	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674748	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674750	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674706	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674707	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674708	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674717	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674718	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674720	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674721	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674725	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674731	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674741	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674752	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674753	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674711	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674712	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674713	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674722	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674723	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674730	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674732	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674738	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674740	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674744	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674745	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674749	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674709	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674710	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674716	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674719	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674726	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674727	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674728	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674729	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674742	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674751	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674754	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293

Source: CnidoSite RNA-seq expression matrices (APOCU_TPM, StringTie quantification over 49 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.