Gene detail

Detailed information of evm.model.Ap14.385 in Astrangia poculata

Genomic Location: Ap14:4036758...4054048
NR annotation: KAJ7386556.1, Cytoplasmic dynein 1 heavy chain 1 [Desmophyllum pertusum]
Species Astrangia poculata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

evm.model.Ap14.385

atggagggactgaacttggtgcacttcctataccagttctctttgcagtttttcttggatatattccagtgcgtgttgtacgagaatcccaaactgaaaggtatgaaagatccacaacagaggctgaaggttttgtcaggcgacttgttccagatcgtgtacaacagagttgcacgtggtatgatgcacgatgataggatcacgtttgccatgctgctgtgccgaatttatctccgtggattgactggagagaccgagtatgaggatgagtttgagatgtatttgcgaggaggagaaactgtcctgtcaggaaaaccaccaagaattgatggactttcacctgaacaggccactggcgtggttcgtttgtccaagctgcctgcttttaaagaactccaggcatacatgaagttcaaccgcaaggatttctttgaatggctggaatctggaaagccagaacgtagcgtgccttcttgttgggactcggaactctctctgtcaaacaatggccaagcagtacatcagttgctagtgatccaggcattacgtcctgacaggatgttggccatggctcagaaagtcgtgctaacaatcctcggcgagaacttcatgcatgacgccgagcaaggactggatctagcatctgttgttgaacacgaggtcaaggcgtcaaccccactgttgatgtgttccgtgacaggttatgatgcaagtggctgggtggatgatcttgctgcagaacagaacaaacagtgtacctccattgctatcgggtctgctgagggtttcagccttgctgacaaagccatcaactctgctactaagtctggaaggtgggttcttctgaagaatgttcaccttgctcctcagtggttagtaactttggagaagaagctgcactcattgaacccgcactctagcttcaggctgtttatgaccatggaaatcaatccaaaggttccagtgaacttgctgagagcttcccgcgtgtttgtgtttgagcctcccccaggagtaaaggccaatctattgagaacattcagtgctgtaccagcagctaggatgtgcaaggcgccaagtgagcgagctcgtctgtatttcctgttggcgtggttccatgctatcgttcaagaacgtcttcgctacgtacctcttggatggtccaagcgttacgagttcagtgagtctgatttgcgagtcgcctgtgacacgctggacacctggttggatgcagtcgctcagggccgtactaatctgcctcccaacaaagtcccttgggatgcccttcaagcgctgttatcccaggcaatttatggcggacgtatcgacaacgattttgatcagcggctgatgacttcctttgtgaatcgcctcttcactgtcagcagttttgaatctgacttccccttggttcttgatgtggatggagaaaaaggcaagaagatcgttatgccagaaggaatcaggcgagaacagtttctgcaatggactgaagctcttcctgatgcccagtctccttcttggctcggcctgcccaacaatgcagagaaggtgctgctgaccacacaaggtcaagacatggttgctaagctactgaagatgcagatgttgagtgatgacgatgagctggcctactctccagactccgctagacacaagaggcgagatagtgatccccgccctgcctggatgaggactttgcataccacagctaccaactggcttaacatgatacccaaggacttgactccattgaagcgtaccttggacaacatcaaggatccactcttccgctactttgaacgcgaggtaaacactggataccagttgttgaacaccatccgagaggacctcaatcacgttgtactcgtgtgtgagagtcagagaaagcctgacaactatctacgaaatctcatgagcgacttggtcaaaggtatcttgccatctaactggagacgttacactgtgccaaaaggcctgactgttctgcagtgggtagctgatttcagtgaccgtgttaaacagttgcaaaagatctcacatgccgctaatactggtggagccaagggtctaaagaatctgcacatttggttgggtggcatgttcgttccagaagcgtacatcacagcaactcgccagttcgtcgcacaggctaacaactggtctcttgaagaactggctttggaggtcaccattgccaatggcccagacgatcgactgactatcgatgactgtagctttggaataaaaggtttgaggcttcagggagcccgttgccttgacaacaagttagaactgacagctacgatttcaacagacctcgcactgaccagcatcaagtggatcagggttgaaccaggatcccatgatagtgaagaggggaaggttacccttcctgtgtatctcaaccaatcacgtaccgagctcctcttcactgttaacatggcaaccagaggtgaacccgctggccaagaacaccgtttttatgagcgcggtgttgcgtttctggcgtcctccttgagtggctga

Transcript

evm.model.Ap14.385

ATGGAGGGACTGAACTTGGTGCACTTCCTATACCAGTTCTCTTTGCAGTTTTTCTTGGATATATTCCAGTGCGTGTTGTACGAGAATCCCAAACTGAAAGGTATGAAAGATCCACAACAGAGGCTGAAGGTTTTGTCAGGCGACTTGTTCCAGATCGTGTACAACAGAGTTGCACGTGGTATGATGCACGATGATAGGATCACGTTTGCCATGCTGCTGTGCCGAATTTATCTCCGTGGATTGACTGGAGAGACCGAGTATGAGGATGAGTTTGAGATGTATTTGCGAGGAGGAGAAACTGTCCTGTCAGGAAAACCACCAAGAATTGATGGACTTTCACCTGAACAGGCCACTGGCGTGGTTCGTTTGTCCAAGCTGCCTGCTTTTAAAGAACTCCAGGCATACATGAAGTTCAACCGCAAGGATTTCTTTGAATGGCTGGAATCTGGAAAGCCAGAACGTAGCGTGCCTTCTTGTTGGGACTCGGAACTCTCTCTGTCAAACAATGGCCAAGCAGTACATCAGTTGCTAGTGATCCAGGCATTACGTCCTGACAGGATGTTGGCCATGGCTCAGAAAGTCGTGCTAACAATCCTCGGCGAGAACTTCATGCATGACGCCGAGCAAGGACTGGATCTAGCATCTGTTGTTGAACACGAGGTCAAGGCGTCAACCCCACTGTTGATGTGTTCCGTGACAGGTTATGATGCAAGTGGCTGGGTGGATGATCTTGCTGCAGAACAGAACAAACAGTGTACCTCCATTGCTATCGGGTCTGCTGAGGGTTTCAGCCTTGCTGACAAAGCCATCAACTCTGCTACTAAGTCTGGAAGGTGGGTTCTTCTGAAGAATGTTCACCTTGCTCCTCAGTGGTTAGTAACTTTGGAGAAGAAGCTGCACTCATTGAACCCGCACTCTAGCTTCAGGCTGTTTATGACCATGGAAATCAATCCAAAGGTTCCAGTGAACTTGCTGAGAGCTTCCCGCGTGTTTGTGTTTGAGCCTCCCCCAGGAGTAAAGGCCAATCTATTGAGAACATTCAGTGCTGTACCAGCAGCTAGGATGTGCAAGGCGCCAAGTGAGCGAGCTCGTCTGTATTTCCTGTTGGCGTGGTTCCATGCTATCGTTCAAGAACGTCTTCGCTACGTACCTCTTGGATGGTCCAAGCGTTACGAGTTCAGTGAGTCTGATTTGCGAGTCGCCTGTGACACGCTGGACACCTGGTTGGATGCAGTCGCTCAGGGCCGTACTAATCTGCCTCCCAACAAAGTCCCTTGGGATGCCCTTCAAGCGCTGTTATCCCAGGCAATTTATGGCGGACGTATCGACAACGATTTTGATCAGCGGCTGATGACTTCCTTTGTGAATCGCCTCTTCACTGTCAGCAGTTTTGAATCTGACTTCCCCTTGGTTCTTGATGTGGATGGAGAAAAAGGCAAGAAGATCGTTATGCCAGAAGGAATCAGGCGAGAACAGTTTCTGCAATGGACTGAAGCTCTTCCTGATGCCCAGTCTCCTTCTTGGCTCGGCCTGCCCAACAATGCAGAGAAGGTGCTGCTGACCACACAAGGTCAAGACATGGTTGCTAAGCTACTGAAGATGCAGATGTTGAGTGATGACGATGAGCTGGCCTACTCTCCAGACTCCGCTAGACACAAGAGGCGAGATAGTGATCCCCGCCCTGCCTGGATGAGGACTTTGCATACCACAGCTACCAACTGGCTTAACATGATACCCAAGGACTTGACTCCATTGAAGCGTACCTTGGACAACATCAAGGATCCACTCTTCCGCTACTTTGAACGCGAGGTAAACACTGGATACCAGTTGTTGAACACCATCCGAGAGGACCTCAATCACGTTGTACTCGTGTGTGAGAGTCAGAGAAAGCCTGACAACTATCTACGAAATCTCATGAGCGACTTGGTCAAAGGTATCTTGCCATCTAACTGGAGACGTTACACTGTGCCAAAAGGCCTGACTGTTCTGCAGTGGGTAGCTGATTTCAGTGACCGTGTTAAACAGTTGCAAAAGATCTCACATGCCGCTAATACTGGTGGAGCCAAGGGTCTAAAGAATCTGCACATTTGGTTGGGTGGCATGTTCGTTCCAGAAGCGTACATCACAGCAACTCGCCAGTTCGTCGCACAGGCTAACAACTGGTCTCTTGAAGAACTGGCTTTGGAGGTCACCATTGCCAATGGCCCAGACGATCGACTGACTATCGATGACTGTAGCTTTGGAATAAAAGGTTTGAGGCTTCAGGGAGCCCGTTGCCTTGACAACAAGTTAGAACTGACAGCTACGATTTCAACAGACCTCGCACTGACCAGCATCAAGTGGATCAGGGTTGAACCAGGATCCCATGATAGTGAAGAGGGGAAGGTTACCCTTCCTGTGTATCTCAACCAATCACGTACCGAGCTCCTCTTCACTGTTAACATGGCAACCAGAGGTGAACCCGCTGGCCAAGAACACCGTTTTTATGAGCGCGGTGTTGCGTTTCTGGCGTCCTCCTTGAGTGGCTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9JHU4	Cytoplasmic dynein 1 heavy chain 1 OS=Mus musculus OX=10090 GN=Dync1h1 PE=1 SV=2
Q14204	Cytoplasmic dynein 1 heavy chain 1 OS=Homo sapiens OX=9606 GN=DYNC1H1 PE=1 SV=5
P38650	Cytoplasmic dynein 1 heavy chain 1 OS=Rattus norvegicus OX=10116 GN=Dync1h1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002054 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF18198 all species →	AAA_lid_11	Dynein heavy chain AAA lid domain	Domain	Interproscan
PF03028 all species →	Dynein_heavy	Dynein heavy chain region D6 P-loop domain	Domain	Interproscan
PF18199 all species →	Dynein_C	Dynein heavy chain C-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR026983 all species →	Family	Dynein heavy chain	Interproscan
IPR043160 all species →	Homologous_superfamily	Dynein heavy chain, C-terminal domain, barrel region	Interproscan
IPR041658 all species →	Domain	Dynein heavy chain AAA lid domain	Interproscan
IPR004273 all species →	Domain	Dynein heavy chain region D6 P-loop domain	Interproscan
IPR041228 all species →	Domain	Dynein heavy chain, C-terminal domain	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR042219 all species →	Homologous_superfamily	Dynein heavy chain AAA lid domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45703 all species →	DYNEIN HEAVY CHAIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0007018 all species →	Biological Process	microtubule-based movement	Interproscan
GO:0030286 all species →	Cellular Component	dynein complex	Interproscan
GO:0045505 all species →	Molecular Function	dynein intermediate chain binding	Interproscan
GO:0051959 all species →	Molecular Function	dynein light intermediate chain binding	Interproscan
GO:0008569 all species →	Molecular Function	minus-end-directed microtubule motor activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for evm.model.Ap14.385.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of evm.model.Ap14.385 across 49 RNA-seq samples of Astrangia poculata. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

49Samples

0TPM > 0

4Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole organism · cold control	14	0	0.00	0.00
whole organism · heat control	12	0	0.00	0.00
whole organism · cold challenge	12	0	0.00	0.00
whole organism · heat challenge	11	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR10674714	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674715	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674724	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674733	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674734	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674735	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674736	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674737	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674739	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674743	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674746	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674747	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674748	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674750	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674706	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674707	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674708	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674717	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674718	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674720	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674721	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674725	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674731	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674741	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674752	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674753	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674711	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674712	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674713	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674722	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674723	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674730	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674732	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674738	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674740	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674744	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674745	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674749	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674709	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674710	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674716	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674719	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674726	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674727	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674728	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674729	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674742	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674751	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674754	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293

Source: CnidoSite RNA-seq expression matrices (APOCU_TPM, StringTie quantification over 49 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.