Gene detail

Detailed information of evm.model.Ap2.3587.1.5f15e442 in Astrangia poculata

Genomic Location: Ap2:36662920...36687272
NR annotation: XP_020616184.1, cytoplasmic aconitate hydratase-like isoform X2 [Orbicella faveolata]
Species Astrangia poculata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

evm.model.Ap2.3587.1.5f15e442

atggcggccgcaaaaagccagtataccgctcagatcaagaaccttcccctgaagtgtggagaataccgttacttcgatgtctccagcttaaacgaagaaagatacgtccgcctaccattttcaatcagggtgcttttggagtctgcggttcgtaactgtgatggctttcaagtgaagtccaaggatgtagaaaacatattggactgggagaataaccaaaaacaaaatgttgaaatcccatttatgccatcaagagtcatcctccaggactttactggggttcctgctgtggttgactttgctgctatgcgggatgccattaaacgacttggaggtgatccaggcagaatcaacccactgtgccctgttgatcttgtcatcgatcattcagtgcaagttgatgtatcaagaagctctacagcacttcagaagaaccaggaaatggagtttatgagaaacagggagaggtttctttttctgaagtggggttcgaaagcattcaagaacatgacaattgtcccacctggctcaggcatagttcatcaggtcaaccttgagtatcttggccgtgttgttttcaacattgacagagtcttgtaccctgacagtgttgtaggaacagactctcacacaactatgatcaatggacttggaattgttggatggggtgttggaggtattgaagctgaggcagtcatgttgggtcaagccatcagtatggtgctgcctaaagttgttggctataagctcactgggcatgtgaagccatttatcacatccactgacgttgtgctcaccattacaaagcaccttcgccaaactggtgttgtgggtaaatttgtggagttctttggtccaggtgttgctcatctgtccatcgcagacagagccacaatcgctaacatgtgtccagagtatggtgcaactgttgggtattttcctgttgatgagaaaagtttactgtatctcagacagacaggtcgcagtgaagaaaatattgaatgtgttgaagcctacatgaaagctacaaaaatgttccgagactattcagacccaagcaatgatccagtgttctcagaggttgtggaactggacttgtccactgtaactccatcattatcggggcccaagagaccccatgacagggttgctgtgtctgaaatgaagcaggatttcatggaatgcttgaataataaagctggatttaaaggttttggtatcccacctgaaaagcacaacatagaggttcctttcacgtttgatggccaagaattcaagttatcacatggttctgtagtgatagctgcaatcacaagttgcacaaacaccagtaatccatcagttatgcttggagcaggactgttagctaagaaagctgtcgatctgggactggacgtcaaaccatacatcaaaacaagcctgtccccaggctctggagttgtcacatactatcttcatgagagtggcgtcataccaagtctggaaaaactaggatttaatgttgtaggctatggttgtatgacgtgcattggcaactctggtcctttgtctgaaccagtatcagaggcaatagaaaagggtgaccttgttgctgtgggtgtgttgtcaggaaacaggaactttgagggacgcatccatcccctgacaagagcaaattaccttgcctcccctcccctggtgattgcctatgccattgctggcaatgtcctcatcgactttgagaaagagcctctgggtatttccaaggacggaaaagaagttttccttagagacatctggccaacaagggaagaaattcaggctgttgagaggcagtatgttattcctgccatgttcaaggaagtctatgccaaagtggcgagtggtaatcctcggtggaattcactggaggcaccgaacagtatgctgtacccgtgggatgtaaaatcaacttatatcaaacatccaccattctttgaaacaatgaacaaagagttgccaacacatgacagcatcagagatgccgctgtgttgttgaacttgggtgactcggtcactactgatcacatatctcccgcgggcagcatatctcgcaccagtcctgctgcgcgttatctggctggacaagggcttgcacctcgtgagtttaactcttatggttctcgccgtggaaacgatgctgtaatggcgcgtggaacatttgccaacatcagactggtgaacaaatttattggaaaagccgctccaaaaacattgcacattccttcaggagatacgatggatgtttttgatgctgctgaacgttaccgccaagaaggacgacaacttattatcctgtccggcaaggattatgggtcaggatcgtcacgtgactgggcggcgaaggggccttggatgcagggcgtcaaggcagtgatatcggagagttttgagcgcattcaccgaagtaatttggtaggaatgggtatcatgccccttgaatatcttcccggcgagaacgcggagagcctggaactcactggaaaagaaagctataccattgagataccggaagacctacaaactggccaaacacttccggttaagttgaatgatggccgctccttcaaagtgaaagttcgttttgacacagacgtggaactgacgtacttcaaacacggaggcatcttgaactacatgataaggagcatgctaaaataa

Transcript

evm.model.Ap2.3587.1.5f15e442

ATGGCGGCCGCAAAAAGCCAGTATACCGCTCAGATCAAGAACCTTCCCCTGAAGTGTGGAGAATACCGTTACTTCGATGTCTCCAGCTTAAACGAAGAAAGATACGTCCGCCTACCATTTTCAATCAGGGTGCTTTTGGAGTCTGCGGTTCGTAACTGTGATGGCTTTCAAGTGAAGTCCAAGGATGTAGAAAACATATTGGACTGGGAGAATAACCAAAAACAAAATGTTGAAATCCCATTTATGCCATCAAGAGTCATCCTCCAGGACTTTACTGGGGTTCCTGCTGTGGTTGACTTTGCTGCTATGCGGGATGCCATTAAACGACTTGGAGGTGATCCAGGCAGAATCAACCCACTGTGCCCTGTTGATCTTGTCATCGATCATTCAGTGCAAGTTGATGTATCAAGAAGCTCTACAGCACTTCAGAAGAACCAGGAAATGGAGTTTATGAGAAACAGGGAGAGGTTTCTTTTTCTGAAGTGGGGTTCGAAAGCATTCAAGAACATGACAATTGTCCCACCTGGCTCAGGCATAGTTCATCAGGTCAACCTTGAGTATCTTGGCCGTGTTGTTTTCAACATTGACAGAGTCTTGTACCCTGACAGTGTTGTAGGAACAGACTCTCACACAACTATGATCAATGGACTTGGAATTGTTGGATGGGGTGTTGGAGGTATTGAAGCTGAGGCAGTCATGTTGGGTCAAGCCATCAGTATGGTGCTGCCTAAAGTTGTTGGCTATAAGCTCACTGGGCATGTGAAGCCATTTATCACATCCACTGACGTTGTGCTCACCATTACAAAGCACCTTCGCCAAACTGGTGTTGTGGGTAAATTTGTGGAGTTCTTTGGTCCAGGTGTTGCTCATCTGTCCATCGCAGACAGAGCCACAATCGCTAACATGTGTCCAGAGTATGGTGCAACTGTTGGGTATTTTCCTGTTGATGAGAAAAGTTTACTGTATCTCAGACAGACAGGTCGCAGTGAAGAAAATATTGAATGTGTTGAAGCCTACATGAAAGCTACAAAAATGTTCCGAGACTATTCAGACCCAAGCAATGATCCAGTGTTCTCAGAGGTTGTGGAACTGGACTTGTCCACTGTAACTCCATCATTATCGGGGCCCAAGAGACCCCATGACAGGGTTGCTGTGTCTGAAATGAAGCAGGATTTCATGGAATGCTTGAATAATAAAGCTGGATTTAAAGGTTTTGGTATCCCACCTGAAAAGCACAACATAGAGGTTCCTTTCACGTTTGATGGCCAAGAATTCAAGTTATCACATGGTTCTGTAGTGATAGCTGCAATCACAAGTTGCACAAACACCAGTAATCCATCAGTTATGCTTGGAGCAGGACTGTTAGCTAAGAAAGCTGTCGATCTGGGACTGGACGTCAAACCATACATCAAAACAAGCCTGTCCCCAGGCTCTGGAGTTGTCACATACTATCTTCATGAGAGTGGCGTCATACCAAGTCTGGAAAAACTAGGATTTAATGTTGTAGGCTATGGTTGTATGACGTGCATTGGCAACTCTGGTCCTTTGTCTGAACCAGTATCAGAGGCAATAGAAAAGGGTGACCTTGTTGCTGTGGGTGTGTTGTCAGGAAACAGGAACTTTGAGGGACGCATCCATCCCCTGACAAGAGCAAATTACCTTGCCTCCCCTCCCCTGGTGATTGCCTATGCCATTGCTGGCAATGTCCTCATCGACTTTGAGAAAGAGCCTCTGGGTATTTCCAAGGACGGAAAAGAAGTTTTCCTTAGAGACATCTGGCCAACAAGGGAAGAAATTCAGGCTGTTGAGAGGCAGTATGTTATTCCTGCCATGTTCAAGGAAGTCTATGCCAAAGTGGCGAGTGGTAATCCTCGGTGGAATTCACTGGAGGCACCGAACAGTATGCTGTACCCGTGGGATGTAAAATCAACTTATATCAAACATCCACCATTCTTTGAAACAATGAACAAAGAGTTGCCAACACATGACAGCATCAGAGATGCCGCTGTGTTGTTGAACTTGGGTGACTCGGTCACTACTGATCACATATCTCCCGCGGGCAGCATATCTCGCACCAGTCCTGCTGCGCGTTATCTGGCTGGACAAGGGCTTGCACCTCGTGAGTTTAACTCTTATGGTTCTCGCCGTGGAAACGATGCTGTAATGGCGCGTGGAACATTTGCCAACATCAGACTGGTGAACAAATTTATTGGAAAAGCCGCTCCAAAAACATTGCACATTCCTTCAGGAGATACGATGGATGTTTTTGATGCTGCTGAACGTTACCGCCAAGAAGGACGACAACTTATTATCCTGTCCGGCAAGGATTATGGGTCAGGATCGTCACGTGACTGGGCGGCGAAGGGGCCTTGGATGCAGGGCGTCAAGGCAGTGATATCGGAGAGTTTTGAGCGCATTCACCGAAGTAATTTGGTAGGAATGGGTATCATGCCCCTTGAATATCTTCCCGGCGAGAACGCGGAGAGCCTGGAACTCACTGGAAAAGAAAGCTATACCATTGAGATACCGGAAGACCTACAAACTGGCCAAACACTTCCGGTTAAGTTGAATGATGGCCGCTCCTTCAAAGTGAAAGTTCGTTTTGACACAGACGTGGAACTGACGTACTTCAAACACGGAGGCATCTTGAACTACATGATAAGGAGCATGCTAAAATAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q01059	Cytoplasmic aconitate hydratase OS=Oryctolagus cuniculus OX=9986 GN=ACO1 PE=1 SV=1
P28271	Cytoplasmic aconitate hydratase OS=Mus musculus OX=10090 GN=Aco1 PE=1 SV=3
P21399	Cytoplasmic aconitate hydratase OS=Homo sapiens OX=9606 GN=ACO1 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002405 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00330 all species →	Aconitase	Aconitase family (aconitate hydratase)	Family	Interproscan
PF00694 all species →	Aconitase_C	Aconitase C-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001030 all species →	Domain	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha domain	Interproscan
IPR015928 all species →	Homologous_superfamily	Aconitase/3-isopropylmalate dehydratase, swivel	Interproscan
IPR015931 all species →	Homologous_superfamily	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 1/3	Interproscan
IPR018136 all species →	Binding_site	Aconitase family, 4Fe-4S cluster binding site	Interproscan
IPR044137 all species →	Domain	Aconitase A, swivel domain	Interproscan
IPR006249 all species →	Family	Aconitase/Iron-responsive element-binding protein 2	Interproscan
IPR036008 all species →	Homologous_superfamily	Aconitase, iron-sulfur domain	Interproscan
IPR000573 all species →	Domain	Aconitase A/isopropylmalate dehydratase small subunit, swivel domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11670 all species →	ACONITASE/IRON-RESPONSIVE ELEMENT FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003994 all species →	Molecular Function	aconitate hydratase activity	Interproscan
GO:0005739 all species →	Cellular Component	mitochondrion	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0006099 all species →	Biological Process	tricarboxylic acid cycle	Interproscan
GO:0006101 all species →	Biological Process	citrate metabolic process	Interproscan
GO:0030350 all species →	Molecular Function	iron-responsive element binding	Interproscan
GO:0051539 all species →	Molecular Function	4 iron, 4 sulfur cluster binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01681	ACO, acnA; aconitate hydratase	EC:4.2.1.3	Carbon fixation pathways in prokaryotes	ko00720	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of evm.model.Ap2.3587.1.5f15e442 across 49 RNA-seq samples of Astrangia poculata. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

49Samples

0TPM > 0

4Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole organism · cold control	14	0	0.00	0.00
whole organism · heat control	12	0	0.00	0.00
whole organism · cold challenge	12	0	0.00	0.00
whole organism · heat challenge	11	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR10674714	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674715	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674724	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674733	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674734	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674735	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674736	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674737	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674739	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674743	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674746	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674747	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674748	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674750	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674706	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674707	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674708	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674717	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674718	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674720	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674721	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674725	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674731	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674741	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674752	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674753	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674711	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674712	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674713	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674722	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674723	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674730	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674732	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674738	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674740	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674744	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674745	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674749	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674709	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674710	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674716	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674719	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674726	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674727	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674728	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674729	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674742	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674751	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674754	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293

Source: CnidoSite RNA-seq expression matrices (APOCU_TPM, StringTie quantification over 49 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.