Gene detail

Detailed information of evm.model.Ap2.3695 in Astrangia poculata

Genomic Location: Ap2:37745528...37759999
NR annotation: KAJ7393952.1, hypothetical protein OS493_003621 [Desmophyllum pertusum]
Species Astrangia poculata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

evm.model.Ap2.3695

atgagtgacaaatggctcggagcatttggcagaatgaagagatcgtcatggctaacagcacatcgctggatgtggatttttctgaacatctggtgcctgtttgatttggtgatgtttccatttctttttgctggattttatttgaagcatctcagaaacaagaacagactgaaagacaaaggaatagagattgcatttttgataaatacaacttcaaagattgccgacaaagctttccttctgataaaaagatgcataaagaaatttatcgcaaagcaaggagatgaaaatgctaaatatcaagttattatccatggagacgattcatctccaagagaaatttgccttaagagtggcatcgaaaaagacctcaagagaggagctacaaagatacctgcccttcacgaagatctcaagaaggttaatttctcaaatgacagttccacgttaaagaaggtgattatcatctttacagaccaccagacaagcctgaaacacgaaaggaccctggtagaaaatcaagttaacgacatgaagggcatcaacctagtcccagtcgccattggaagccacgtcaacatacgggaattagagaagattgccaataatggacatgacatcattcactttggagaattcgaaaggccagagacagttagcaaacggatatggcacgaacttcatggaaaagacatgtttgagagctacttggagtattttactactccttatttcatctttgttcgtgacacgttaagttatcttactctccttggcctgcactttgccttatgtcttgcgccatcgagcattccattcagcggtctagagtgggccatcctggttttctttatgggacggatacttttggaaagcaaacaattcctgaacgtaaaaacacaaaacgctcatctggagagggaagacatcgatgcaaacaagcagattggatataagcgtaaaacaggtggtaaaaatgaagataaccaaaacaatcaagtatcaagatcaactttatttttaaagaaatgcggaaaatacctaagcgatcgatggaatattctggattccaccaccctgatgatctacttcatcacttttctgctgagaatgtacacgtgggccgtgtcgtcctcagtgtctaacaaccgtgctattgttatagctggttatctgtacggcctcaacaccatgtttcttacactcagagcgtttggccaagtgatggaaaccattaaaggggtgggtgccatccaaatagctctgttccacatcattggtgatattgctacaatattttggcagttcgttgcaactattttggctttttcgatcgccataacaaaggtgtatatggccgaaaggtcgtacattgtccaggaaagcaacaaagatgatcttgcttgtaaaacgtctggaatatcatgttggtgggcgatgttccgacatcttttctggtccttactgggtatagctgaattagaaccactggactcagtcgacagtccttcagtgacgttggctcgttttctttttggggcttttctaatcatgggagtaattctgcttgtgaacatgatgatagctctcttgtcgaacacgtaccagcgagtggaggacaacgcttgtatggagtggtccttcaagaaagccatcacaatacagacatacagcacataccatccaataccagttcctcttaatctcatctctaatctttgcatcggtctgtaccatttatgtaagaagtgtatggcaggctgtagaggacaagaagataacagtgatcgcaatgatgtccatggccgaatgcaatctctgaatgcggttgtaaaaaatcttcagcttgcatactttgcaacttatggatattgtttccctcttactgatgacagaaaaatggaccaagtagttgaagaaaccgagagaaacaggcaaatggccaatcagattgctcacaggacattcacagcgcatgcatctgagcaagtgatgctacctaccggtccaaaggcgtggcaaagtcaaggtgttagaatagaaggctgtctcttagcttgtgagggtggaaacttctgtaatgtatgtaagggtgaatcagatgaatgccacggtgcaagatacctcgtgcctttttctccagaatttccacattttgaggttctgattcaagagacagaagagcaaaggtttcttggagtgggagtggtttggaaggagtacggaaggcatgccatgcccggacatatgaacgaaactgttggatatcttgtcgatgaaggcaaagttttcggaccttttgaacctgtaaaccttgcagagggaaaagaatatgaaggtgccatggcttacagaggagatctgattggctgtacggtcaaatttgacgagaaaaaagatggaaaagttccaattgtgttcactttaaacggcaaacagataactcaagataagattttaatggagtataagccatctcaaaagtcgctttacccatttataagcatgggacacacaggaatacgagtgctggccaagatgtgtccacgtccgaacgatgattttcagctgattgggaagattaaagccactacagatggaatgacagacaaaatgatttcaagactgaaacaggttggcgcagtggttcggcggatggacgaggagctaaacagtacaaaaaacgagtttgaaaagctgattaacttagttgtaaaagatttacgacacttaaaacaacttattgtaaatcccgatcaattggtgttcgatgatgggttaattgctttagaggatgtggcactttgtgagagtgcgttccctgacttcactttatcaagggaagagaacgattatcgaatacttgagcctgtaagagagaaagaaatatgctacctgaatgagcaagatggaccagatttggaagaccaactgccacaaaattcactcttaaaaagagcacaggagaacttggaagagctgacgcaaacaacagacatgggatttacttcggtcttgcagagtttgaaagcgatagagatcaaaacgaaaaatcacaagaaatgccaaagagaaaatcaagaaaaggttgaaggaaaattgggccgccttaaagaattgctaagagatctccttaaatctcatcgggggcaatcgagtgctctccctcccccgcgccctagaccaagtgggttcgaagagagtataactaaaacttgtctttaa

Transcript

evm.model.Ap2.3695

ATGAGTGACAAATGGCTCGGAGCATTTGGCAGAATGAAGAGATCGTCATGGCTAACAGCACATCGCTGGATGTGGATTTTTCTGAACATCTGGTGCCTGTTTGATTTGGTGATGTTTCCATTTCTTTTTGCTGGATTTTATTTGAAGCATCTCAGAAACAAGAACAGACTGAAAGACAAAGGAATAGAGATTGCATTTTTGATAAATACAACTTCAAAGATTGCCGACAAAGCTTTCCTTCTGATAAAAAGATGCATAAAGAAATTTATCGCAAAGCAAGGAGATGAAAATGCTAAATATCAAGTTATTATCCATGGAGACGATTCATCTCCAAGAGAAATTTGCCTTAAGAGTGGCATCGAAAAAGACCTCAAGAGAGGAGCTACAAAGATACCTGCCCTTCACGAAGATCTCAAGAAGGTTAATTTCTCAAATGACAGTTCCACGTTAAAGAAGGTGATTATCATCTTTACAGACCACCAGACAAGCCTGAAACACGAAAGGACCCTGGTAGAAAATCAAGTTAACGACATGAAGGGCATCAACCTAGTCCCAGTCGCCATTGGAAGCCACGTCAACATACGGGAATTAGAGAAGATTGCCAATAATGGACATGACATCATTCACTTTGGAGAATTCGAAAGGCCAGAGACAGTTAGCAAACGGATATGGCACGAACTTCATGGAAAAGACATGTTTGAGAGCTACTTGGAGTATTTTACTACTCCTTATTTCATCTTTGTTCGTGACACGTTAAGTTATCTTACTCTCCTTGGCCTGCACTTTGCCTTATGTCTTGCGCCATCGAGCATTCCATTCAGCGGTCTAGAGTGGGCCATCCTGGTTTTCTTTATGGGACGGATACTTTTGGAAAGCAAACAATTCCTGAACGTAAAAACACAAAACGCTCATCTGGAGAGGGAAGACATCGATGCAAACAAGCAGATTGGATATAAGCGTAAAACAGGTGGTAAAAATGAAGATAACCAAAACAATCAAGTATCAAGATCAACTTTATTTTTAAAGAAATGCGGAAAATACCTAAGCGATCGATGGAATATTCTGGATTCCACCACCCTGATGATCTACTTCATCACTTTTCTGCTGAGAATGTACACGTGGGCCGTGTCGTCCTCAGTGTCTAACAACCGTGCTATTGTTATAGCTGGTTATCTGTACGGCCTCAACACCATGTTTCTTACACTCAGAGCGTTTGGCCAAGTGATGGAAACCATTAAAGGGGTGGGTGCCATCCAAATAGCTCTGTTCCACATCATTGGTGATATTGCTACAATATTTTGGCAGTTCGTTGCAACTATTTTGGCTTTTTCGATCGCCATAACAAAGGTGTATATGGCCGAAAGGTCGTACATTGTCCAGGAAAGCAACAAAGATGATCTTGCTTGTAAAACGTCTGGAATATCATGTTGGTGGGCGATGTTCCGACATCTTTTCTGGTCCTTACTGGGTATAGCTGAATTAGAACCACTGGACTCAGTCGACAGTCCTTCAGTGACGTTGGCTCGTTTTCTTTTTGGGGCTTTTCTAATCATGGGAGTAATTCTGCTTGTGAACATGATGATAGCTCTCTTGTCGAACACGTACCAGCGAGTGGAGGACAACGCTTGTATGGAGTGGTCCTTCAAGAAAGCCATCACAATACAGACATACAGCACATACCATCCAATACCAGTTCCTCTTAATCTCATCTCTAATCTTTGCATCGGTCTGTACCATTTATGTAAGAAGTGTATGGCAGGCTGTAGAGGACAAGAAGATAACAGTGATCGCAATGATGTCCATGGCCGAATGCAATCTCTGAATGCGGTTGTAAAAAATCTTCAGCTTGCATACTTTGCAACTTATGGATATTGTTTCCCTCTTACTGATGACAGAAAAATGGACCAAGTAGTTGAAGAAACCGAGAGAAACAGGCAAATGGCCAATCAGATTGCTCACAGGACATTCACAGCGCATGCATCTGAGCAAGTGATGCTACCTACCGGTCCAAAGGCGTGGCAAAGTCAAGGTGTTAGAATAGAAGGCTGTCTCTTAGCTTGTGAGGGTGGAAACTTCTGTAATGTATGTAAGGGTGAATCAGATGAATGCCACGGTGCAAGATACCTCGTGCCTTTTTCTCCAGAATTTCCACATTTTGAGGTTCTGATTCAAGAGACAGAAGAGCAAAGGTTTCTTGGAGTGGGAGTGGTTTGGAAGGAGTACGGAAGGCATGCCATGCCCGGACATATGAACGAAACTGTTGGATATCTTGTCGATGAAGGCAAAGTTTTCGGACCTTTTGAACCTGTAAACCTTGCAGAGGGAAAAGAATATGAAGGTGCCATGGCTTACAGAGGAGATCTGATTGGCTGTACGGTCAAATTTGACGAGAAAAAAGATGGAAAAGTTCCAATTGTGTTCACTTTAAACGGCAAACAGATAACTCAAGATAAGATTTTAATGGAGTATAAGCCATCTCAAAAGTCGCTTTACCCATTTATAAGCATGGGACACACAGGAATACGAGTGCTGGCCAAGATGTGTCCACGTCCGAACGATGATTTTCAGCTGATTGGGAAGATTAAAGCCACTACAGATGGAATGACAGACAAAATGATTTCAAGACTGAAACAGGTTGGCGCAGTGGTTCGGCGGATGGACGAGGAGCTAAACAGTACAAAAAACGAGTTTGAAAAGCTGATTAACTTAGTTGTAAAAGATTTACGACACTTAAAACAACTTATTGTAAATCCCGATCAATTGGTGTTCGATGATGGGTTAATTGCTTTAGAGGATGTGGCACTTTGTGAGAGTGCGTTCCCTGACTTCACTTTATCAAGGGAAGAGAACGATTATCGAATACTTGAGCCTGTAAGAGAGAAAGAAATATGCTACCTGAATGAGCAAGATGGACCAGATTTGGAAGACCAACTGCCACAAAATTCACTCTTAAAAAGAGCACAGGAGAACTTGGAAGAGCTGACGCAAACAACAGACATGGGATTTACTTCGGTCTTGCAGAGTTTGAAAGCGATAGAGATCAAAACGAAAAATCACAAGAAATGCCAAAGAGAAAATCAAGAAAAGGTTGAAGGAAAATTGGGCCGCCTTAAAGAATTGCTAAGAGATCTCCTTAAATCTCATCGGGGGCAATCGAGTGCTCTCCCTCCCCCGCGCCCTAGACCAAGTGGGTTCGAAGAGAGTATAACTAAAACTTGTCTTTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9R244	Short transient receptor potential channel 2 OS=Mus musculus OX=10090 GN=Trpc2 PE=2 SV=2
Q9R283	Short transient receptor potential channel 2 OS=Rattus norvegicus OX=10116 GN=Trpc2 PE=2 SV=2
Q9QUQ5	Short transient receptor potential channel 4 OS=Mus musculus OX=10090 GN=Trpc4 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000221 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00520 all species →	Ion_trans	Ion transport protein	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR043136 all species →	Homologous_superfamily	B30.2/SPRY domain superfamily	Interproscan
IPR002035 all species →	Domain	von Willebrand factor, type A	Interproscan
IPR044736 all species →	Domain	Ran-binding protein Vid30/RanBPM/SPLA, SPRY domain	Interproscan
IPR036465 all species →	Homologous_superfamily	von Willebrand factor A-like domain superfamily	Interproscan
IPR002153 all species →	Family	Transient receptor potential channel, canonical	Interproscan
IPR005821 all species →	Domain	Ion transport domain	Interproscan
IPR013320 all species →	Homologous_superfamily	Concanavalin A-like lectin/glucanase domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10117 all species →	TRANSIENT RECEPTOR POTENTIAL CHANNEL	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005262 all species →	Molecular Function	calcium channel activity	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0070588 all species →	Biological Process	calcium ion transmembrane transport	Interproscan
GO:0005216 all species →	Molecular Function	monoatomic ion channel activity	Interproscan
GO:0006811 all species →	Biological Process	monoatomic ion transport	Interproscan
GO:0055085 all species →	Biological Process	transmembrane transport	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0005887 all species →	Cellular Component	plasma membrane	Interproscan
GO:0015279 all species →	Molecular Function	store-operated calcium channel activity	Interproscan
GO:0034703 all species →	Cellular Component	cation channel complex	Interproscan
GO:0051480 all species →	Biological Process	regulation of cytosolic calcium ion concentration	Interproscan
GO:0070679 all species →	Molecular Function	inositol 1,4,5 trisphosphate binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for evm.model.Ap2.3695.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of evm.model.Ap2.3695 across 49 RNA-seq samples of Astrangia poculata. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

49Samples

0TPM > 0

4Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole organism · cold control	14	0	0.00	0.00
whole organism · heat control	12	0	0.00	0.00
whole organism · cold challenge	12	0	0.00	0.00
whole organism · heat challenge	11	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR10674714	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674715	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674724	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674733	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674734	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674735	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674736	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674737	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674739	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674743	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674746	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674747	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674748	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674750	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674706	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674707	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674708	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674717	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674718	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674720	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674721	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674725	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674731	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674741	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674752	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674753	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674711	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674712	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674713	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674722	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674723	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674730	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674732	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674738	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674740	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674744	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674745	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674749	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674709	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674710	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674716	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674719	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674726	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674727	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674728	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674729	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674742	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674751	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674754	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293

Source: CnidoSite RNA-seq expression matrices (APOCU_TPM, StringTie quantification over 49 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.