Gene detail

Detailed information of evm.model.Ap3.1250_evm.model.Ap3.1253 in Astrangia poculata

Genomic Location: Ap3:13886787...13954721
NR annotation: XP_020627098.1, tRNA (uracil-5-)-methyltransferase homolog A-like [Orbicella faveolata]
Species Astrangia poculata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

evm.model.Ap3.1250_evm.model.Ap3.1253

atggccgacgaacagaacttcgatagtgcggaggaagtagctccctcgactgttaaccaggcaactcaactcactaaggaaacaccgaatgttaaacaggaagtttcgtcgccgatacctgggtttccacctttgtttcagtttgcaaaactgcaaacagaagccagttgttggggttcaaacgcagcaagtttcacgagttgcagtgatgcaatcgcagacaaaacatcgtcggccgttgataatggggacagctacgaactttcagccagttcagagtctaataatgctgatgaatcaaaacctgtgaatggtttggatattgtgataagtatggatgacaaacctgaaaatgttcctgaacaagaaaacggagaagaagaagaagacaacgacatcgaactggacaaagatggagatggcgtaataaacgacgaacctgacgaagaagaagcagaatctgatccttatttctacaccaaacgagacgaatttacttctgagatatacaaaattgaacttcagaatttgccaaagaaatgtggttacaagcaattcaagaaaatgatagctaacaggctgaatgtaagacctgtaaaggtgaaactacccccaggagcaaaccatgcctatgtcacattcaggaatgaagaggagagacgattggccatcagatcattatcaggacacaagtggaaaggaaaagtactttctgctaagcctgcccagcctcttcctgatccactagctcttcagcgagcagaaggaatggcaagaaagagaatgattcaggatgcagcacgatcaaatgttgatgccaagagaataaaagtagacgacgaagaagaaggggaagaactcgctatttctgtcaggttaaaccatgtagtaactccactgtgggatcagccatacagtaagcaaatggaaactaagcggaataacatgttggaaattttgggaaaactcacaagaaagttgaaagccataatggtgcttaagaacaactgggttgaacaagaaagtgctaagaggaatggtatttgttgtgagctgctagactgtgtagaatcacctgttcttgatgggtatcgtaataagtgtgagttcactattgcagaaggccctgatggagccaaaactgttggattccgtcttggctcatataaagagggttacagtggagttgtagaaccatctgaatgcattcatatctcagaaaaggccaagaccatagccaaggctttccagacttatgtgagacagtctccattaccagtgtatgatctctgtttccacactggctactggcagacgcttactgttcgtagctccatgtatggtgacaccatggcagtcctacagtttagtccacaaaaaatgaccacggaagaaattgaagctgagaaaaatcgcatcagtgagtatttcaaaactggagaaggcaaagacgttacgctcacatccctttatttgcaaataaaccacacaagggctgttggaggaaatgcagaagctccttttgtccatatcatgggagaggagcacatttatgaagagctttgtggcctgaggttcagaatatctcctgactctttcttccaagtcaacaccaaggcaactgaaaagctgtttgatttacttaaagagtggtgtggagacaatctagatgagacagttgtgctggacatttgttgtggtaccggagctcttggtctctgtctggcccagagcgtcaaacgtgtaattggtgttgaaatcattgaaaacgccgtggaggacgctaaggcaaatgcacagcttaacggagttacaaacgcgcagtttgtttgtgggaaagcagaagatatcattgttgacgtgttcaagaacatgccacgaaaaacaaaaatcatcggtattatggaccctcctcgcgccggtctgcatcaatcagttctccatgccatcaggaagagtcgtcgaatggacaaactgatctatgtatcgtgtaacccgagtgctgcgttcgtcaattttctcgatttgtgcaggccaacctcgaagagaatcaaaacagctccattccgtctggtgaaggcggtgccagtggatctgttccctcacaccaaacactgtgaattactgctactgtttgaaagagacatgacttcagttgacgcagccaagttttataagtggtactactga

Transcript

evm.model.Ap3.1250_evm.model.Ap3.1253

TGTCAATACAATATGGCCGACGAACAGAACTTCGATAGTGCGGAGGAAGTAGCTCCCTCGACTGTTAACCAGGCAACTCAACTCACTAAGGAAACACCGAATGTTAAACAGGAAGTTTCGTCGCCGATACCTGGGTTTCCACCTTTGTTTCAGTTTGCAAAACTGCAAACAGAAGCCAGTTGTTGGGGTTCAAACGCAGCAAGTTTCACGAGTTGCAGTGATGCAATCGCAGACAAAACATCGTCGGCCGTTGATAATGGGGACAGCTACGAACTTTCAGCCAGTTCAGAGTCTAATAATGCTGATGAATCAAAACCTGTGAATGGTTTGGATATTGTGATAAGTATGGATGACAAACCTGAAAATGTTCCTGAACAAGAAAACGGAGAAGAAGAAGAAGACAACGACATCGAACTGGACAAAGATGGAGATGGCGTAATAAACGACGAACCTGACGAAGAAGAAGCAGAATCTGATCCTTATTTCTACACCAAACGAGACGAATTTACTTCTGAGATATACAAAATTGAACTTCAGAATTTGCCAAAGAAATGTGGTTACAAGCAATTCAAGAAAATGATAGCTAACAGGCTGAATGTAAGACCTGTAAAGGTGAAACTACCCCCAGGAGCAAACCATGCCTATGTCACATTCAGGAATGAAGAGGAGAGACGATTGGCCATCAGATCATTATCAGGACACAAGTGGAAAGGAAAAGTACTTTCTGCTAAGCCTGCCCAGCCTCTTCCTGATCCACTAGCTCTTCAGCGAGCAGAAGGAATGGCAAGAAAGAGAATGATTCAGGATGCAGCACGATCAAATGTTGATGCCAAGAGAATAAAAGTAGACGACGAAGAAGAAGGGGAAGAACTCGCTATTTCTGTCAGGTTAAACCATGTAGTAACTCCACTGTGGGATCAGCCATACAGTAAGCAAATGGAAACTAAGCGGAATAACATGTTGGAAATTTTGGGAAAACTCACAAGAAAGTTGAAAGCCATAATGGTGCTTAAGAACAACTGGGTTGAACAAGAAAGTGCTAAGAGGAATGGTATTTGTTGTGAGCTGCTAGACTGTGTAGAATCACCTGTTCTTGATGGGTATCGTAATAAGTGTGAGTTCACTATTGCAGAAGGCCCTGATGGAGCCAAAACTGTTGGATTCCGTCTTGGCTCATATAAAGAGGGTTACAGTGGAGTTGTAGAACCATCTGAATGCATTCATATCTCAGAAAAGGCCAAGACCATAGCCAAGGCTTTCCAGACTTATGTGAGACAGTCTCCATTACCAGTGTATGATCTCTGTTTCCACACTGGCTACTGGCAGACGCTTACTGTTCGTAGCTCCATGTATGGTGACACCATGGCAGTCCTACAGTTTAGTCCACAAAAAATGACCACGGAAGAAATTGAAGCTGAGAAAAATCGCATCAGTGAGTATTTCAAAACTGGAGAAGGCAAAGACGTTACGCTCACATCCCTTTATTTGCAAATAAACCACACAAGGGCTGTTGGAGGAAATGCAGAAGCTCCTTTTGTCCATATCATGGGAGAGGAGCACATTTATGAAGAGCTTTGTGGCCTGAGGTTCAGAATATCTCCTGACTCTTTCTTCCAAGTCAACACCAAGGCAACTGAAAAGCTGTTTGATTTACTTAAAGAGTGGTGTGGAGACAATCTAGATGAGACAGTTGTGCTGGACATTTGTTGTGGTACCGGAGCTCTTGGTCTCTGTCTGGCCCAGAGCGTCAAACGTGTAATTGGTGTTGAAATCATTGAAAACGCCGTGGAGGACGCTAAGGCAAATGCACAGCTTAACGGAGTTACAAACGCGCAGTTTGTTTGTGGGAAAGCAGAAGATATCATTGTTGACGTGTTCAAGAACATGCCACGAAAAACAAAAATCATCGGTATTATGGACCCTCCTCGCGCCGGTCTGCATCAATCAGTTCTCCATGCCATCAGGAAGAGTCGTCGAATGGACAAACTGATCTATGTATCGTGTAACCCGAGTGCTGCGTTCGTCAATTTTCTCGATTTGTGCAGGCCAACCTCGAAGAGAATCAAAACAGCTCCATTCCGTCTGGTGAAGGCGGTGCCAGTGGATCTGTTCCCTCACACCAAACACTGTGAATTACTGCTACTGTTTGAAAGAGACATGACTTCAGTTGACGCAGCCAAGTTTTATAAGTGGTACTACTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8IZ69	tRNA (uracil-5-)-methyltransferase homolog A OS=Homo sapiens OX=9606 GN=TRMT2A PE=1 SV=2
Q8BNV1	tRNA (uracil-5-)-methyltransferase homolog A OS=Mus musculus OX=10090 GN=Trmt2a PE=1 SV=2
Q96GJ1	tRNA (uracil-5-)-methyltransferase homolog B OS=Homo sapiens OX=9606 GN=TRMT2B PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003170 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF05958 all species →	tRNA_U5-meth_tr	tRNA (Uracil-5-)-methyltransferase	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR012677 all species →	Homologous_superfamily	Nucleotide-binding alpha-beta plait domain superfamily	Interproscan
IPR034262 all species →	Domain	TRMT2A, RNA recognition motif	Interproscan
IPR010280 all species →	Family	(Uracil-5)-methyltransferase family	Interproscan
IPR029063 all species →	Homologous_superfamily	S-adenosyl-L-methionine-dependent methyltransferase superfamily	Interproscan
IPR000504 all species →	Domain	RNA recognition motif domain	Interproscan
IPR045850 all species →	Family	tRNA (uracil(54)-C(5))-methyltransferase, metazoa type	Interproscan
IPR035979 all species →	Homologous_superfamily	RNA-binding domain superfamily	Interproscan
IPR030390 all species →	Active_site	RNA methyltransferase TrmA, active site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45904 all species →	TRNA (URACIL-5-)-METHYLTRANSFERASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006396 all species →	Biological Process	RNA processing	Interproscan
GO:0008173 all species →	Molecular Function	RNA methyltransferase activity	Interproscan
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K15332	TRMT2A; tRNA (uracil-5-)-methyltransferase	EC:2.1.1.-	Transfer RNA biogenesis	ko03016	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of evm.model.Ap3.1250_evm.model.Ap3.1253 across 49 RNA-seq samples of Astrangia poculata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

49Samples

37TPM > 0

4Conditions

957.1Max TPM

265.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
whole organism · cold control	14	10	335.51	957.13
whole organism · heat control	12	11	201.73	458.88
whole organism · cold challenge	12	9	271.63	836.75
whole organism · heat challenge	11	7	237.67	951.08

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR10674736	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	957.13
SRR10674733	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	734.88
SRR10674737	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	667.36
SRR10674747	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	462.16
SRR10674734	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	428.79
SRR10674750	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	420.56
SRR10674748	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	402.37
SRR10674746	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	223.39
SRR10674715	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	201.64
SRR10674724	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	198.90
SRR10674714	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674735	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674739	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674743	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674721	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	458.88
SRR10674718	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	407.93
SRR10674752	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	305.18
SRR10674717	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	231.25
SRR10674725	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	213.62
SRR10674753	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	195.28
SRR10674708	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	168.88
SRR10674731	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	167.53
SRR10674741	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	112.69
SRR10674707	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	82.29
SRR10674706	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	77.23
SRR10674720	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674740	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	836.75
SRR10674744	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	389.87
SRR10674712	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	388.87
SRR10674749	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	335.80
SRR10674732	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	324.47
SRR10674713	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	302.26
SRR10674711	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	251.66
SRR10674730	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	219.32
SRR10674745	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	210.55
SRR10674722	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674723	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674738	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674742	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	951.08
SRR10674751	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	566.99
SRR10674709	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	425.77
SRR10674716	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	219.46
SRR10674727	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	182.00
SRR10674754	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	165.38
SRR10674710	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	103.70
SRR10674719	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674726	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674728	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674729	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00

Source: CnidoSite RNA-seq expression matrices (APOCU_TPM, StringTie quantification over 49 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.