Gene detail

Detailed information of evm.model.Ap3.1289.1.5f15e4a9 in Astrangia poculata

Genomic Location: Ap3:14530320...14556273
NR annotation: CAH3108449.1, unnamed protein product [Pocillopora meandrina]
Species Astrangia poculata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

evm.model.Ap3.1289.1.5f15e4a9

atggaggcccaagacatctttggtcttgactttgattttgatgagtttgagaagtatggaagagatgatttcttgtcagaagaagatgaagatgaatatgaagacgaggaagaagaagatggtgcactgaaaagaccaaaaaagaaatcaactaagaaatctatttatgaagtatttgaaccaagtgagcttgagaagggaatgttaaccaacaaagacaatgaaatcaaaactgcagatgtgcctgaaagattccaggttcgtgattttcctgtgaagtcaacagaagaaggagagcttgatgaagaagctgactggatttacaaacatgcatttctggatatgccgatatctcagcagcaggaccttcttgatggtgatatccattctcatgctaaaacacccaaaccatacagtgccgttagtaagatcagggaggctttgaaccttatgcgcaaccaactctttgaggttccatttattgccaactacagaaaagagtacattgaacctgaactgaatgttgaagacttgtggaagatatgggaatgggatgaaaagtggtgccagctacgcactcgtaaggagaatctccatcatctgtttcaagaaatgcaggattaccagtttaacaagattcaagagagtggtgatcagcctcttgatgatgatacaagaattttacaggctgaagatgttgataggctggatggagttgagacaatggaacagctaaaagatgtatacagccattttatgttgtactacaaaaacgatatccctgctatgtgggaagccaagagaaaaaagaatcaatcagctgtgagtgaggaggctgatggtgaaccaaaggtcacaccacaaaaacagaaaatgccagcaaagcgtgatctttatactatatgtagacaagcaggtgttagtggtttggccagaaagtttggcttaacgccagatcagtttggagagaacttgcgtgacaactaccaaagacacgagacacagcaacatcctcttgaaccagatgacacagctgagacttatctcagtagtacattttcaactgttgatcaagttctagaggctgcacagcatatggtagccatgcaaattgcaagagacccattagttcggcagtgtgtaagacagatattctatgagagagccaaactcaagataaaaccaaccaaaaaaggaaggaaggaaattgatgagtctcactcctgcagtacgttcaagtttattaaacacaaaccagtcaaggatcttaaaggagatcagtttctacgaatgtgtaaagctgaagaggatggtttactcgccataagcattggaatcgacctggacaagagtgcaggataccagagttactttgatgaagtcaagcagttatattacagggatgaatttagccatctagtacaagagtggaacacacaaagaatgaatgccttgtcacgagccttcgatcaaatgctgtatccacttcttgaaaaagaacttaaactcaaactcttacaggaagccaagaattttgttgtaaagtcatgttgtcgccgattgaggtcatggattgaagttgctccataccaacccgagcagcacgtggacgagcaagactatgatgacaacaccaacagtgaagggctccgtgtgttggcatgttccatctcagccagtccagatacgccagccttcctggccatgctggatggaggaggacaagtgaatgactaccttagactcaagtatctactcaacagacggaatacaacaagagctaaagaacgagaggataaggaaaaggacctgcagacattgaagcagtttatactcaagaagcgtcctcaggttgtggttgtctcagctgaatgtcgcgagacagttgctgtggtggatgacatgaaaatgtgtatagcagagctagaacaagaaaatcagataccaaccatctctgtagaagctctggatggtgaagtagcacgtgtgttcatgtcttctcctcgatctgagaatgagtttcgtgagtacccctccctcctgcgtcatgcagtgtcccttggtcgtaggatccaggatccactcactgagtttgctgctctgtgtgttgaggaagatgaacttctgtgtttacgactgcatccattccaggaccatgtatccaaagagcatcttgtgaaaagcctccaccaagaatttgtgacagttgtaaatgaggcaggtgttgaccccaatcgccttttggagcatccgcacacagttgcgttgttgcaattcgtgtgtggtctgggacctaggaaggcatcttccttattaaagagtctacgtcagcaatgtaccagacttgagaaccgctcccagcttgtgaccgtgtgtggcctgggtccccaggtgtttctgaactgcgcaggtttcattaagattgacacagcagccatcagtgacacgaccacggactacatcgaagtgcttgacggttcacgagttcatccggagacctacgagtgggccaagaaaatggccgtcgacgcactcgagtacgacgaggcgacaatggaatcgaacccttcatctgctttggaagaaattctcgaggctcccgacaggttaaaagacctggatttagacgcgtttgcggaagagcttgagcgtcaaggctacggaaacaagcgaataacattgtatgacatccgagatgagttgtttggccagtacagggagcgccgctccccgttccgttctctagcagtagaggaacgcttcagactgctgactggtgagacaaatgagtctctttacgttggcaagatggtggtatgtactgtgactggctttgccaacaggaaacctccgcgtgatatgatcgaccaggcgcagccagtcaggaatgacgagacaggccagtggcaatgccccttctgtttgcaggataccttccctgatctgagcgaggtgtggacacatcttgataatggaagctgtgcaggacaggcagttggcgttcgtaccagattggaaaatggattgtccgggtttattgctacaaagatgataagcgacaaatctatcagttctcctcacgagagagtcaaggtctgctgcagtgaaaaacattccctcctttttctttctcgagcattttccgcagctccctcagtctaa

Transcript

evm.model.Ap3.1289.1.5f15e4a9

CGCTCTTATGGAGGCCCAAGACATCTTTGGTCTTGACTTTGATTTTGATGAGTTTGAGAAGTATGGAAGAGATGATTTCTTGTCAGAAGAAGATGAAGATGAATATGAAGACGAGGAAGAAGAAGATGGTGCACTGAAAAGACCAAAAAAGAAATCAACTAAGAAATCTATTTATGAAGTATTTGAACCAAGTGAGCTTGAGAAGGGAATGTTAACCAACAAAGACAATGAAATCAAAACTGCAGATGTGCCTGAAAGATTCCAGGTTCGTGATTTTCCTGTGAAGTCAACAGAAGAAGGAGAGCTTGATGAAGAAGCTGACTGGATTTACAAACATGCATTTCTGGATATGCCGATATCTCAGCAGCAGGACCTTCTTGATGGTGATATCCATTCTCATGCTAAAACACCCAAACCATACAGTGCCGTTAGTAAGATCAGGGAGGCTTTGAACCTTATGCGCAACCAACTCTTTGAGGTTCCATTTATTGCCAACTACAGAAAAGAGTACATTGAACCTGAACTGAATGTTGAAGACTTGTGGAAGATATGGGAATGGGATGAAAAGTGGTGCCAGCTACGCACTCGTAAGGAGAATCTCCATCATCTGTTTCAAGAAATGCAGGATTACCAGTTTAACAAGATTCAAGAGAGTGGTGATCAGCCTCTTGATGATGATACAAGAATTTTACAGGCTGAAGATGTTGATAGGCTGGATGGAGTTGAGACAATGGAACAGCTAAAAGATGTATACAGCCATTTTATGTTGTACTACAAAAACGATATCCCTGCTATGTGGGAAGCCAAGAGAAAAAAGAATCAATCAGCTGTGAGTGAGGAGGCTGATGGTGAACCAAAGGTCACACCACAAAAACAGAAAATGCCAGCAAAGCGTGATCTTTATACTATATGTAGACAAGCAGGTGTTAGTGGTTTGGCCAGAAAGTTTGGCTTAACGCCAGATCAGTTTGGAGAGAACTTGCGTGACAACTACCAAAGACACGAGACACAGCAACATCCTCTTGAACCAGATGACACAGCTGAGACTTATCTCAGTAGTACATTTTCAACTGTTGATCAAGTTCTAGAGGCTGCACAGCATATGGTAGCCATGCAAATTGCAAGAGACCCATTAGTTCGGCAGTGTGTAAGACAGATATTCTATGAGAGAGCCAAACTCAAGATAAAACCAACCAAAAAAGGAAGGAAGGAAATTGATGAGTCTCACTCCTGCAGTACGTTCAAGTTTATTAAACACAAACCAGTCAAGGATCTTAAAGGAGATCAGTTTCTACGAATGTGTAAAGCTGAAGAGGATGGTTTACTCGCCATAAGCATTGGAATCGACCTGGACAAGAGTGCAGGATACCAGAGTTACTTTGATGAAGTCAAGCAGTTATATTACAGGGATGAATTTAGCCATCTAGTACAAGAGTGGAACACACAAAGAATGAATGCCTTGTCACGAGCCTTCGATCAAATGCTGTATCCACTTCTTGAAAAAGAACTTAAACTCAAACTCTTACAGGAAGCCAAGAATTTTGTTGTAAAGTCATGTTGTCGCCGATTGAGGTCATGGATTGAAGTTGCTCCATACCAACCCGAGCAGCACGTGGACGAGCAAGACTATGATGACAACACCAACAGTGAAGGGCTCCGTGTGTTGGCATGTTCCATCTCAGCCAGTCCAGATACGCCAGCCTTCCTGGCCATGCTGGATGGAGGAGGACAAGTGAATGACTACCTTAGACTCAAGTATCTACTCAACAGACGGAATACAACAAGAGCTAAAGAACGAGAGGATAAGGAAAAGGACCTGCAGACATTGAAGCAGTTTATACTCAAGAAGCGTCCTCAGGTTGTGGTTGTCTCAGCTGAATGTCGCGAGACAGTTGCTGTGGTGGATGACATGAAAATGTGTATAGCAGAGCTAGAACAAGAAAATCAGATACCAACCATCTCTGTAGAAGCTCTGGATGGTGAAGTAGCACGTGTGTTCATGTCTTCTCCTCGATCTGAGAATGAGTTTCGTGAGTACCCCTCCCTCCTGCGTCATGCAGTGTCCCTTGGTCGTAGGATCCAGGATCCACTCACTGAGTTTGCTGCTCTGTGTGTTGAGGAAGATGAACTTCTGTGTTTACGACTGCATCCATTCCAGGACCATGTATCCAAAGAGCATCTTGTGAAAAGCCTCCACCAAGAATTTGTGACAGTTGTAAATGAGGCAGGTGTTGACCCCAATCGCCTTTTGGAGCATCCGCACACAGTTGCGTTGTTGCAATTCGTGTGTGGTCTGGGACCTAGGAAGGCATCTTCCTTATTAAAGAGTCTACGTCAGCAATGTACCAGACTTGAGAACCGCTCCCAGCTTGTGACCGTGTGTGGCCTGGGTCCCCAGGTGTTTCTGAACTGCGCAGGTTTCATTAAGATTGACACAGCAGCCATCAGTGACACGACCACGGACTACATCGAAGTGCTTGACGGTTCACGAGTTCATCCGGAGACCTACGAGTGGGCCAAGAAAATGGCCGTCGACGCACTCGAGTACGACGAGGCGACAATGGAATCGAACCCTTCATCTGCTTTGGAAGAAATTCTCGAGGCTCCCGACAGGTTAAAAGACCTGGATTTAGACGCGTTTGCGGAAGAGCTTGAGCGTCAAGGCTACGGAAACAAGCGAATAACATTGTATGACATCCGAGATGAGTTGTTTGGCCAGTACAGGGAGCGCCGCTCCCCGTTCCGTTCTCTAGCAGTAGAGGAACGCTTCAGACTGCTGACTGGTGAGACAAATGAGTCTCTTTACGTTGGCAAGATGGTGGTATGTACTGTGACTGGCTTTGCCAACAGGAAACCTCCGCGTGATATGATCGACCAGGCGCAGCCAGTCAGGAATGACGAGACAGGCCAGTGGCAATGCCCCTTCTGTTTGCAGGATACCTTCCCTGATCTGAGCGAGGTGTGGACACATCTTGATAATGGAAGCTGTGCAGGACAGGCAGTTGGCGTTCGTACCAGATTGGAAAATGGATTGTCCGGGTTTATTGCTACAAAGATGATAAGCGACAAATCTATCAGTTCTCCTCACGAGAGAGTCAAGGTCTGCTGCAGTGAAAAACATTCCCTCCTTTTTCTTTCTCGAGCATTTTCCGCAGCTCCCTCAGTCTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q7KZ85	Transcription elongation factor SPT6 OS=Homo sapiens OX=9606 GN=SUPT6H PE=1 SV=2
Q8UVK2	Transcription elongation factor SPT6 OS=Danio rerio OX=7955 GN=supt6h PE=1 SV=1
Q62383	Transcription elongation factor SPT6 OS=Mus musculus OX=10090 GN=Supt6h PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003299 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF14641 all species →	HTH_44	Helix-turn-helix DNA-binding domain of SPT6	Domain	Interproscan
PF14635 all species →	HHH_7	Helix-hairpin-helix motif	Domain	Interproscan
PF14639 all species →	YqgF	Holliday-junction resolvase-like of SPT6	Domain	Interproscan
PF17674 all species →	HHH_9	HHH domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR028088 all species →	Domain	Helix-turn-helix DNA-binding domain of Spt6	Interproscan
IPR023319 all species →	Homologous_superfamily	Tex-like protein, HTH domain superfamily	Interproscan
IPR023323 all species →	Homologous_superfamily	Tex-like domain superfamily	Interproscan
IPR032706 all species →	Domain	Transcription elongation factor Spt6, helix-hairpin-helix motif	Interproscan
IPR012337 all species →	Homologous_superfamily	Ribonuclease H-like superfamily	Interproscan
IPR028231 all species →	Domain	Transcription elongation factor Spt6, YqgF domain	Interproscan
IPR010994 all species →	Homologous_superfamily	RuvA domain 2-like	Interproscan
IPR037027 all species →	Homologous_superfamily	YqgF/RNase H-like domain superfamily	Interproscan
IPR017072 all species →	Family	Transcription elongation factor Spt6	Interproscan
IPR042066 all species →	Homologous_superfamily	Spt6, Death-like domain	Interproscan
IPR041692 all species →	Domain	HHH domain 9	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10145 all species →	TRANSCRIPTION ELONGATION FACTOR SPT6	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0006139 all species →	Biological Process	nucleobase-containing compound metabolic process	Interproscan
GO:0006368 all species →	Biological Process	transcription elongation by RNA polymerase II	Interproscan
GO:0008023 all species →	Cellular Component	transcription elongation factor complex	Interproscan
GO:0031491 all species →	Molecular Function	nucleosome binding	Interproscan
GO:0034728 all species →	Biological Process	nucleosome organization	Interproscan
GO:0042393 all species →	Molecular Function	histone binding	Interproscan
GO:0140673 all species →	Biological Process	transcription elongation-coupled chromatin remodeling	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11292	SUPT6H, SPT6; transcription elongation factor SPT6	-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of evm.model.Ap3.1289.1.5f15e4a9 across 49 RNA-seq samples of Astrangia poculata. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

49Samples

0TPM > 0

4Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole organism · cold control	14	0	0.00	0.00
whole organism · heat control	12	0	0.00	0.00
whole organism · cold challenge	12	0	0.00	0.00
whole organism · heat challenge	11	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR10674714	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674715	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674724	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674733	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674734	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674735	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674736	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674737	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674739	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674743	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674746	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674747	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674748	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674750	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674706	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674707	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674708	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674717	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674718	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674720	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674721	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674725	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674731	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674741	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674752	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674753	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674711	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674712	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674713	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674722	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674723	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674730	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674732	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674738	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674740	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674744	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674745	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674749	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674709	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674710	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674716	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674719	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674726	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674727	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674728	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674729	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674742	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674751	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674754	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293

Source: CnidoSite RNA-seq expression matrices (APOCU_TPM, StringTie quantification over 49 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.