Gene detail

Detailed information of evm.model.Ap3.970 in Astrangia poculata

Genomic Location: Ap3:10793154...10809078
NR annotation: KAJ7387204.1, hypothetical protein OS493_004174 [Desmophyllum pertusum]
Species Astrangia poculata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

evm.model.Ap3.970

atggcccagaaagcaatggaggtgttgttcgcttttattgcgtttttttcatgcttttacctccctgttagcactgccaaggctaagttaccaggcatgctatttccaagggattccgagagtcgagaagtgaaggatttgagtggattttggaatttccgggcagatatgtccgcaaacaggaacgccgggtttgagcagagctggtttgctaaacctctttggcagacaggtgaagtcattcctatgcctgtcccatcaagctacaatgatatcacacaggacagggccttaagggacttcattggttgggtgtggtatgacagagaagtttatgcctcgaagacatggaaatcagaccaaatcagggttgttctccgttttgagagtgcacattataacaccatggtgtggctaaatggcaaagaagtgatgacccattctggaggtcatttgccatttgaagcagatgtcacatcactgttatcctttggtaaagttaacagaatcacagcagcagtgaacaatacattaacaccttctaccctaccccctggggccattaaatatcttgtagatggggataggtatcctccaggatattttatccaagaaacttcctttgactttttcaactatgccggtattcatcgtcctgtcaagctgtacaccacccctgttgtgtatctgtcagacatcaccataacaacaagccactcagatcaggaaggtgtggtcaagttttctagcacagtgtcttcctcaggacctgttaatgtgtcaatgaagtacgaacttgtggacaaggccggcaatgtcgtagcctcagttcaaggttctgacctgttggaaggaacactggttgttaagaatccaaagctttggtggccaattggaatgagtgatcagccagcatacctctattcactgaaggtgacaacacattcagtttcaccagatgtggatgacgtgtaccatttgcctgtgggcattagatcagttgaggtgaagggaacaaagtttcttataaacaatgagtcattctacttcaaaggatttggcaagcatgaagattctgatattcgtggcaaaggaatggactatgctctcattgccaaagacttcaatctgatcaaatggcttggggcaaactgtttccgcaccagtcactacccatacgctgatgaaatcatggacatggctgatcaacaaggaattgttgttattgatgaaagccctggagttggaattaaaagagacaacttcaggaacgacactctccaacaccacttggatgtcatggctgagttggtacgtcgtgacaagaatcgaccatcagtagtcatgtggtctgtagccaatgaaccagcatccaattatgctgaggcaggaccctacttccaatcagtaatcgaattcactcgcttcttggacccaacccgtcctgtaacatttgtcactgcagcaaaagctgagacggaccacgcggtgcagtatgttgatgtcattttgtgcaatcgatactacgcctggtaccaagatgccggtcaaatacaactcattagtcggcagctggagggagagcttagggcctggtttgacaagttccataaaccagttgcgcaatctgagtatggggctgacacaattgcgggacttcacatggatccccctgttatgtttactgaagactatcaggttgaaacaattcagcagtacttccccgtgtttgataaactaaggaaagaattctttgttggtgaactgatatggaactttgcggactttatgaccaaacaacagacaacgcgagttgtgggtaacaagaaagggatcctgactcgccagcgacagccgaaagccgctgctcgtgttctgcgccagcggtacctgaacatcacagtgggaagaagtagcacgagtgaagatgatgtggacgttttactcagattcgacagtcacaacatggcaaacgtggctcgagtcgatacagagacttag

Transcript

evm.model.Ap3.970

ATGGCCCAGAAAGCAATGGAGGTGTTGTTCGCTTTTATTGCGTTTTTTTCATGCTTTTACCTCCCTGTTAGCACTGCCAAGGCTAAGTTACCAGGCATGCTATTTCCAAGGGATTCCGAGAGTCGAGAAGTGAAGGATTTGAGTGGATTTTGGAATTTCCGGGCAGATATGTCCGCAAACAGGAACGCCGGGTTTGAGCAGAGCTGGTTTGCTAAACCTCTTTGGCAGACAGGTGAAGTCATTCCTATGCCTGTCCCATCAAGCTACAATGATATCACACAGGACAGGGCCTTAAGGGACTTCATTGGTTGGGTGTGGTATGACAGAGAAGTTTATGCCTCGAAGACATGGAAATCAGACCAAATCAGGGTTGTTCTCCGTTTTGAGAGTGCACATTATAACACCATGGTGTGGCTAAATGGCAAAGAAGTGATGACCCATTCTGGAGGTCATTTGCCATTTGAAGCAGATGTCACATCACTGTTATCCTTTGGTAAAGTTAACAGAATCACAGCAGCAGTGAACAATACATTAACACCTTCTACCCTACCCCCTGGGGCCATTAAATATCTTGTAGATGGGGATAGGTATCCTCCAGGATATTTTATCCAAGAAACTTCCTTTGACTTTTTCAACTATGCCGGTATTCATCGTCCTGTCAAGCTGTACACCACCCCTGTTGTGTATCTGTCAGACATCACCATAACAACAAGCCACTCAGATCAGGAAGGTGTGGTCAAGTTTTCTAGCACAGTGTCTTCCTCAGGACCTGTTAATGTGTCAATGAAGTACGAACTTGTGGACAAGGCCGGCAATGTCGTAGCCTCAGTTCAAGGTTCTGACCTGTTGGAAGGAACACTGGTTGTTAAGAATCCAAAGCTTTGGTGGCCAATTGGAATGAGTGATCAGCCAGCATACCTCTATTCACTGAAGGTGACAACACATTCAGTTTCACCAGATGTGGATGACGTGTACCATTTGCCTGTGGGCATTAGATCAGTTGAGGTGAAGGGAACAAAGTTTCTTATAAACAATGAGTCATTCTACTTCAAAGGATTTGGCAAGCATGAAGATTCTGATATTCGTGGCAAAGGAATGGACTATGCTCTCATTGCCAAAGACTTCAATCTGATCAAATGGCTTGGGGCAAACTGTTTCCGCACCAGTCACTACCCATACGCTGATGAAATCATGGACATGGCTGATCAACAAGGAATTGTTGTTATTGATGAAAGCCCTGGAGTTGGAATTAAAAGAGACAACTTCAGGAACGACACTCTCCAACACCACTTGGATGTCATGGCTGAGTTGGTACGTCGTGACAAGAATCGACCATCAGTAGTCATGTGGTCTGTAGCCAATGAACCAGCATCCAATTATGCTGAGGCAGGACCCTACTTCCAATCAGTAATCGAATTCACTCGCTTCTTGGACCCAACCCGTCCTGTAACATTTGTCACTGCAGCAAAAGCTGAGACGGACCACGCGGTGCAGTATGTTGATGTCATTTTGTGCAATCGATACTACGCCTGGTACCAAGATGCCGGTCAAATACAACTCATTAGTCGGCAGCTGGAGGGAGAGCTTAGGGCCTGGTTTGACAAGTTCCATAAACCAGTTGCGCAATCTGAGTATGGGGCTGACACAATTGCGGGACTTCACATGGATCCCCCTGTTATGTTTACTGAAGACTATCAGGTTGAAACAATTCAGCAGTACTTCCCCGTGTTTGATAAACTAAGGAAAGAATTCTTTGTTGGTGAACTGATATGGAACTTTGCGGACTTTATGACCAAACAACAGACAACGCGAGTTGTGGGTAACAAGAAAGGGATCCTGACTCGCCAGCGACAGCCGAAAGCCGCTGCTCGTGTTCTGCGCCAGCGGTACCTGAACATCACAGTGGGAAGAAGTAGCACGAGTGAAGATGATGTGGACGTTTTACTCAGATTCGACAGTCACAACATGGCAAACGTGGCTCGAGTCGATACAGAGACTTAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O97524	Beta-glucuronidase OS=Felis catus OX=9685 GN=GUSB PE=1 SV=1
O18835	Beta-glucuronidase OS=Canis lupus familiaris OX=9615 GN=GUSB PE=1 SV=1
Q4FAT7	Beta-glucuronidase OS=Sus scrofa OX=9823 GN=GUSB PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001408 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02837 all species →	Glyco_hydro_2_N	Glycosyl hydrolases family 2, sugar binding domain	Domain	Interproscan
PF02836 all species →	Glyco_hydro_2_C	Glycosyl hydrolases family 2, TIM barrel domain	Domain	Interproscan
PF00703 all species →	Glyco_hydro_2	Glycosyl hydrolases family 2	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR006104 all species →	Domain	Glycosyl hydrolases family 2, sugar binding domain	Interproscan
IPR008979 all species →	Homologous_superfamily	Galactose-binding-like domain superfamily	Interproscan
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan
IPR023232 all species →	Active_site	Glycoside hydrolase, family 2, active site	Interproscan
IPR006103 all species →	Domain	Glycoside hydrolase family 2, catalytic domain	Interproscan
IPR036156 all species →	Homologous_superfamily	Beta-Galactosidase/glucuronidase domain superfamily	Interproscan
IPR006102 all species →	Domain	Glycoside hydrolase, family 2, immunoglobulin-like beta-sandwich	Interproscan
IPR006101 all species →	Family	Glycoside hydrolase, family 2	Interproscan
IPR017853 all species →	Homologous_superfamily	Glycoside hydrolase superfamily	Interproscan
IPR023230 all species →	Conserved_site	Glycoside hydrolase, family 2, conserved site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10066 all species →	BETA-GLUCURONIDASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004553 all species →	Molecular Function	hydrolase activity, hydrolyzing O-glycosyl compounds	Interproscan
GO:0005975 all species →	Biological Process	carbohydrate metabolic process	Interproscan
GO:0004566 all species →	Molecular Function	beta-glucuronidase activity	Interproscan
GO:0019391 all species →	Biological Process	obsolete glucuronoside catabolic process	Interproscan
GO:0030246 all species →	Molecular Function	carbohydrate binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01195	uidA, GUSB; beta-glucuronidase	EC:3.2.1.31	Lysosome	ko04142	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of evm.model.Ap3.970 across 49 RNA-seq samples of Astrangia poculata. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

49Samples

0TPM > 0

4Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole organism · cold control	14	0	0.00	0.00
whole organism · heat control	12	0	0.00	0.00
whole organism · cold challenge	12	0	0.00	0.00
whole organism · heat challenge	11	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR10674714	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674715	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674724	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674733	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674734	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674735	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674736	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674737	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674739	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674743	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674746	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674747	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674748	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674750	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674706	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674707	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674708	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674717	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674718	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674720	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674721	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674725	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674731	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674741	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674752	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674753	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674711	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674712	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674713	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674722	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674723	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674730	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674732	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674738	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674740	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674744	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674745	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674749	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674709	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674710	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674716	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674719	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674726	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674727	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674728	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674729	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674742	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674751	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674754	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293

Source: CnidoSite RNA-seq expression matrices (APOCU_TPM, StringTie quantification over 49 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.