Gene detail

Detailed information of evm.model.Ap4.1554 in Astrangia poculata

Genomic Location: Ap4:16047090...16065405
NR annotation: KAJ7376468.1, Acyl-coenzyme A synthetase acsm3, mitochondrial [Desmophyllum pertusum]
Species Astrangia poculata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

evm.model.Ap4.1554

atgaacttcgttactgctgataatcgatgcaggacagaagttaacatacctggcatggctctaaaaggattcgtcttcaagaaaacggcagtaacagcccctcataagtgtgatgtcagatgtgaaagagaaatcacctgtcaaagctacaatttcgtcatagcggaaaagtcgtgcgaactgaataatcgaaccaaagaggcaagacccgagaattttcactcggacaaagcaagctcaaggttttatatcagacgcttgaacggcagggctcctctgggttccattccggagctacctgcgcagtcatgtcacgaaataaaggcaagcgaaggcaaagacaccattagcaacaagtactggctggatccatctttgactggagtggcagttttggtttattgtgacatgaacttagaaggatacacaggagatggaagctggtgcgcagtatcaggggaaccttttacctgtgcaggcaaagtggacggtattaaccctgatccgttcatctgttcggcaatgtattacggatgctatggtggcgtgacagcggaatttgagtgcgcggagggtcttctgtttaacaggaaaaccaaaaagttggatctcaaaactgctttgctgatggctgacgtggtaatctggggaacaaaagattttcaagttccgaagtactttaactttgctgacgtcatagacgaatgggcacaaaacgaaaagcaaggcacaaggaaaagtaatcacccagctctgtggtgggttgatggagtcggcaacgaagttaagtggagttttcaagatgtcgccataaaatcgaaaaagactgccagtatcctgtccagagcagccgacatcagaccaggagaccatgtgatggtacccacaattccagagtactggctgatacaggctgcgtgtttaagaacaggtggagtattaattataactccagtaaatattggtccaaaagaacttcacaggagaattttaaagtcaaaaccagtgtgtgtggtggcggccccttgcgatcagataaaaagcgaattaattgatattgtcaatcagataactagctctggtcaggtagaagtaagaagcagaattgtgatcaacagaataaaagacgaaaaatgggagggctggttgtcatttgaagacctttttgaaactgcgagtgctgattttcagtctgttaagtccttaagctcagcacccactaacatattcttcacaagcggcacaagtggtaatgcgaagatggttgaacattgtcatgccagcatgggtctgggtagcacaggaatgcgacaatgtcgttttacagaaacagattttaactgggcttgttcttctactggatggtcctggctactttcggacagtttctacagcacttggtccgtgggagccggagcttttgcacactataagaaagtaactgccagagaattcctcgagactcttcaggagtatcctataactcaatgtacagctgatcattctatgtacatgaaggccttgtacgaggaggatctgaagagcttcagatttcccacactaaagctttgtttcggcggaggagaaccatcgaacaaacaagtgttgcgaaaatggaaagacgtaaccggagtggaactttgggactattatggacaaacggagataggtaatttaactatgtcacgagaaccaggagatgacgaacatctggtttctgctggcaaagcttttcctggagtcgatttgcttgttattgacgataattaccaagaagtgcctccaggtacactgggaagggttgtgattcgggtaaagccttaccgtcctgttggattgtttaattgttacaagggtgatcctgagaaaacggcagcatgttgctctggagatttctacatcacaggtgatatgggtcgaatggacgcagaaggttatttctggatcaccggacgagctgatgaaatgctcattaactgggacacatcgcttttggtgaacccttatgaggtggaggagaatctgaaagaacatcctggtgtaagggactgtgctgtggttagcagtcctcaccttaacaaacaggtaataaaggcgttcattgagttgtcaccttgttttagacacaaagatcacgatgaaatgataaaagaactacaggaccacttgaaatacaatgctgcggcctggctgtgtccagatgagatggaagttgtcgaggatcttcccaaaactatcgttggaaagattaacagacgagaactggccaatagagagtggagtgcagagtaa

Transcript

evm.model.Ap4.1554

ATGAACTTCGTTACTGCTGATAATCGATGCAGGACAGAAGTTAACATACCTGGCATGGCTCTAAAAGGATTCGTCTTCAAGAAAACGGCAGTAACAGCCCCTCATAAGTGTGATGTCAGATGTGAAAGAGAAATCACCTGTCAAAGCTACAATTTCGTCATAGCGGAAAAGTCGTGCGAACTGAATAATCGAACCAAAGAGGCAAGACCCGAGAATTTTCACTCGGACAAAGCAAGCTCAAGGTTTTATATCAGACGCTTGAACGGCAGGGCTCCTCTGGGTTCCATTCCGGAGCTACCTGCGCAGTCATGTCACGAAATAAAGGCAAGCGAAGGCAAAGACACCATTAGCAACAAGTACTGGCTGGATCCATCTTTGACTGGAGTGGCAGTTTTGGTTTATTGTGACATGAACTTAGAAGGATACACAGGAGATGGAAGCTGGTGCGCAGTATCAGGGGAACCTTTTACCTGTGCAGGCAAAGTGGACGGTATTAACCCTGATCCGTTCATCTGTTCGGCAATGTATTACGGATGCTATGGTGGCGTGACAGCGGAATTTGAGTGCGCGGAGGGTCTTCTGTTTAACAGGAAAACCAAAAAGTTGGATCTCAAAACTGCTTTGCTGATGGCTGACGTGGTAATCTGGGGAACAAAAGATTTTCAAGTTCCGAAGTACTTTAACTTTGCTGACGTCATAGACGAATGGGCACAAAACGAAAAGCAAGGCACAAGGAAAAGTAATCACCCAGCTCTGTGGTGGGTTGATGGAGTCGGCAACGAAGTTAAGTGGAGTTTTCAAGATGTCGCCATAAAATCGAAAAAGACTGCCAGTATCCTGTCCAGAGCAGCCGACATCAGACCAGGAGACCATGTGATGGTACCCACAATTCCAGAGTACTGGCTGATACAGGCTGCGTGTTTAAGAACAGGTGGAGTATTAATTATAACTCCAGTAAATATTGGTCCAAAAGAACTTCACAGGAGAATTTTAAAGTCAAAACCAGTGTGTGTGGTGGCGGCCCCTTGCGATCAGATAAAAAGCGAATTAATTGATATTGTCAATCAGATAACTAGCTCTGGTCAGGTAGAAGTAAGAAGCAGAATTGTGATCAACAGAATAAAAGACGAAAAATGGGAGGGCTGGTTGTCATTTGAAGACCTTTTTGAAACTGCGAGTGCTGATTTTCAGTCTGTTAAGTCCTTAAGCTCAGCACCCACTAACATATTCTTCACAAGCGGCACAAGTGGTAATGCGAAGATGGTTGAACATTGTCATGCCAGCATGGGTCTGGGTAGCACAGGAATGCGACAATGTCGTTTTACAGAAACAGATTTTAACTGGGCTTGTTCTTCTACTGGATGGTCCTGGCTACTTTCGGACAGTTTCTACAGCACTTGGTCCGTGGGAGCCGGAGCTTTTGCACACTATAAGAAAGTAACTGCCAGAGAATTCCTCGAGACTCTTCAGGAGTATCCTATAACTCAATGTACAGCTGATCATTCTATGTACATGAAGGCCTTGTACGAGGAGGATCTGAAGAGCTTCAGATTTCCCACACTAAAGCTTTGTTTCGGCGGAGGAGAACCATCGAACAAACAAGTGTTGCGAAAATGGAAAGACGTAACCGGAGTGGAACTTTGGGACTATTATGGACAAACGGAGATAGGTAATTTAACTATGTCACGAGAACCAGGAGATGACGAACATCTGGTTTCTGCTGGCAAAGCTTTTCCTGGAGTCGATTTGCTTGTTATTGACGATAATTACCAAGAAGTGCCTCCAGGTACACTGGGAAGGGTTGTGATTCGGGTAAAGCCTTACCGTCCTGTTGGATTGTTTAATTGTTACAAGGGTGATCCTGAGAAAACGGCAGCATGTTGCTCTGGAGATTTCTACATCACAGGTGATATGGGTCGAATGGACGCAGAAGGTTATTTCTGGATCACCGGACGAGCTGATGAAATGCTCATTAACTGGGACACATCGCTTTTGGTGAACCCTTATGAGGTGGAGGAGAATCTGAAAGAACATCCTGGTGTAAGGGACTGTGCTGTGGTTAGCAGTCCTCACCTTAACAAACAGGTAATAAAGGCGTTCATTGAGTTGTCACCTTGTTTTAGACACAAAGATCACGATGAAATGATAAAAGAACTACAGGACCACTTGAAATACAATGCTGCGGCCTGGCTGTGTCCAGATGAGATGGAAGTTGTCGAGGATCTTCCCAAAACTATCGTTGGAAAGATTAACAGACGAGAACTGGCCAATAGAGAGTGGAGTGCAGAGTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P0C7M7	Acyl-coenzyme A synthetase ACSM4, mitochondrial OS=Homo sapiens OX=9606 GN=ACSM4 PE=1 SV=1
Q80W40	Acyl-coenzyme A synthetase ACSM4, mitochondrial OS=Mus musculus OX=10090 GN=Acsm4 PE=2 SV=1
Q7TN78	Acyl-coenzyme A synthetase ACSM4, mitochondrial OS=Rattus norvegicus OX=10116 GN=Acsm4 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001394 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00024 all species →	PAN_1	PAN domain	Domain	Interproscan
PF00501 all species →	AMP-binding	AMP-binding enzyme	Family	Interproscan
PF01607 all species →	CBM_14	Chitin binding Peritrophin-A domain	Domain	Interproscan
PF13193 all species →	AMP-binding_C	AMP-binding enzyme C-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR003609 all species →	Domain	PAN/Apple domain	Interproscan
IPR036508 all species →	Homologous_superfamily	Chitin binding domain superfamily	Interproscan
IPR036056 all species →	Homologous_superfamily	Fibrinogen-like, C-terminal	Interproscan
IPR000873 all species →	Domain	AMP-dependent synthetase/ligase domain	Interproscan
IPR045851 all species →	Homologous_superfamily	AMP-binding enzyme, C-terminal domain superfamily	Interproscan
IPR002557 all species →	Domain	Chitin binding domain	Interproscan
IPR020845 all species →	Conserved_site	AMP-binding, conserved site	Interproscan
IPR042099 all species →	Homologous_superfamily	ANL, N-terminal domain	Interproscan
IPR025110 all species →	Domain	AMP-binding enzyme, C-terminal domain	Interproscan
IPR051087 all species →	Family	Mitochondrial Acyl-CoA Synthetase Medium-Chain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR43605 all species →	ACYL-COENZYME A SYNTHETASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0008061 all species →	Molecular Function	chitin binding	Interproscan
GO:0005576 all species →	Cellular Component	extracellular region	Interproscan
GO:0004321 all species →	Molecular Function	fatty-acyl-CoA synthase activity	Interproscan
GO:0005759 all species →	Cellular Component	mitochondrial matrix	Interproscan
GO:0006633 all species →	Biological Process	fatty acid biosynthetic process	Interproscan
GO:0006637 all species →	Biological Process	acyl-CoA metabolic process	Interproscan
GO:0015645 all species →	Molecular Function	fatty acid ligase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for evm.model.Ap4.1554.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of evm.model.Ap4.1554 across 49 RNA-seq samples of Astrangia poculata. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

49Samples

0TPM > 0

4Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole organism · cold control	14	0	0.00	0.00
whole organism · heat control	12	0	0.00	0.00
whole organism · cold challenge	12	0	0.00	0.00
whole organism · heat challenge	11	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR10674714	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674715	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674724	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674733	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674734	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674735	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674736	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674737	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674739	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674743	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674746	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674747	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674748	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674750	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674706	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674707	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674708	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674717	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674718	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674720	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674721	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674725	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674731	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674741	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674752	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674753	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674711	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674712	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674713	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674722	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674723	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674730	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674732	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674738	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674740	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674744	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674745	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674749	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674709	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674710	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674716	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674719	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674726	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674727	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674728	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674729	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674742	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674751	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674754	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293

Source: CnidoSite RNA-seq expression matrices (APOCU_TPM, StringTie quantification over 49 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.