Gene detail

Detailed information of evm.model.Ap4.6984 in Astrangia poculata

Genomic Location: Ap4:54586748...54593766
NR annotation: KAJ7383144.1, replication licensing factor Cdt1 [Desmophyllum pertusum]
Species Astrangia poculata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

evm.model.Ap4.6984

atgtcgtcaatggcggcgatggaacaggcaactttaggtcagtattttaccacaagaaggaagggtctcgaaggcatccatcccgcaaagcgtagaaaagtcgatgtgactgaaactgaaagcgacgttgccgtgaggcgcagtacacgatcgaagagacaggtagcgtcttctcagtcgaagattacacgagctaccaaagctgctaaaagcaacgcgaaggaatccttgaatgaagaaagcacccattctacaagtaaacttggtagtaaggttgccagcgaaaccacatcactgtttgatgaccacgcttttgcagaagcattgatcgggaaattgaccgacgcgcagagaaagcgcaagatggcgtcctcgacgcaaatggaagaaacgatccctagggagacaagctctgttgaatcttcgcaggtgcaaggaagcaagggcgaaatgaaatccaagccaaaaagtcggcgacaaacagcgagatcttcaaaatcagcaaagcaagcggagggaagtaagaattcaaagattatcaatgctaccgagcaggtcgtttcttccctttcaaaggaaaaatcgctgggtgaccaaactccttgtgaagctgccgtcccagcggagaaagaaatatcatcttccccctccaaaacacctcccgtcgtaagaagaattggtagcggtgtcaaagcgaacacctggatagcagaacaggccaaaatggttcttagccgagggagagcggctgtaaatttgagtcagaaaggtagaagcaaagaagataagaagatcactgcctcaaaggatagtggttcagtggagataacaggattttggggtagtggagggagagaaaagggcaggaacctgggagaaaagggggtggaattcccagaggaggaacagaaagaagattacaaaaattgttttgcacatttcattgattttgcaaaagaaatgggacaagagaaagagaaccacaacagaaaggggctcagtaactccaaagctgatgcagtgggtgttaatgccagcaaagctcaagaagatctagccaaggctagaaaactgatcaagagcatgagatcactggagaaaagtgcttccaaaccctcaccatcttcaactgaggataacagaccaagacttcatcaaatcgcatcacccaagaaaagtacagataaaggatcagagagcatgaaggaagttccagcctatgcacgattccatgccctggctcagcccaccccatcagaggcatctcctgcaaccttacccctcccgtataagtacaagactttggctgagatgttccgctgcactgacacagtgttgaatttgttggggcagcgaaaagagaagtgcacatttccaaaacttagggatgctgtacaacagatgtcaaggaagcggtttgagaaaaggcatctggcacaaatgaaaactgtgtatccatttgctcttgaattccgtcaagacaaatgtcctgggaagtcatcatcatttgagttgaatgtagagtttggaaaaacagaggaatcttgtagtaaattaacattgactgctagtgagcttctggcaaggaaagatacctttcagaaaaatctgctgaaaataaccaagaaacaccatcaggacttcctctccgaccttaatccacccgtgtcagttaatgatgacaagatcatgcgctggcatccaaagtttcatcttgacaatgtcccagatgtagatgaagctgatctgcctcagcctccagtggtgaagacttacagcagcgcacatgatgtgttggaaaaagcacgggacatgatggccccaagggttgagaaagcactaagaacagttgctacaaaggaacaagcagaaaaagagcaaagaacaacaagcaaggacaacatgtcagaaaagaaagatgcgacaaagttgattgaaaatgcacaaaataagaacaacctgaagcataaaacagccttaaagggaatctcacaagatctgctgaacaagattcgccagaaagaagcaaagaaaatagaggaaagcatgacgagagatcccgtagtcgacaagaagcttgccatgaaggaacgtcttcctgacctgtgcagaatactcaaggcttacttttctgctgaacgcaaagcagctattcctctggaggatgcgacagtgaaactctcggagagctacaaggcctccctatcttcagtacaagttgaagaacacatcagattcatgtcacagcttgttccagaatggatctcagttcttacagtaaggaaatgtgcgtacgtcaaaatcaacaagactgctgatgtgaacaatgtgataaacaaacttatggcaaaagaaattcaataa

Transcript

evm.model.Ap4.6984

ATGTCGTCAATGGCGGCGATGGAACAGGCAACTTTAGGTCAGTATTTTACCACAAGAAGGAAGGGTCTCGAAGGCATCCATCCCGCAAAGCGTAGAAAAGTCGATGTGACTGAAACTGAAAGCGACGTTGCCGTGAGGCGCAGTACACGATCGAAGAGACAGGTAGCGTCTTCTCAGTCGAAGATTACACGAGCTACCAAAGCTGCTAAAAGCAACGCGAAGGAATCCTTGAATGAAGAAAGCACCCATTCTACAAGTAAACTTGGTAGTAAGGTTGCCAGCGAAACCACATCACTGTTTGATGACCACGCTTTTGCAGAAGCATTGATCGGGAAATTGACCGACGCGCAGAGAAAGCGCAAGATGGCGTCCTCGACGCAAATGGAAGAAACGATCCCTAGGGAGACAAGCTCTGTTGAATCTTCGCAGGTGCAAGGAAGCAAGGGCGAAATGAAATCCAAGCCAAAAAGTCGGCGACAAACAGCGAGATCTTCAAAATCAGCAAAGCAAGCGGAGGGAAGTAAGAATTCAAAGATTATCAATGCTACCGAGCAGGTCGTTTCTTCCCTTTCAAAGGAAAAATCGCTGGGTGACCAAACTCCTTGTGAAGCTGCCGTCCCAGCGGAGAAAGAAATATCATCTTCCCCCTCCAAAACACCTCCCGTCGTAAGAAGAATTGGTAGCGGTGTCAAAGCGAACACCTGGATAGCAGAACAGGCCAAAATGGTTCTTAGCCGAGGGAGAGCGGCTGTAAATTTGAGTCAGAAAGGTAGAAGCAAAGAAGATAAGAAGATCACTGCCTCAAAGGATAGTGGTTCAGTGGAGATAACAGGATTTTGGGGTAGTGGAGGGAGAGAAAAGGGCAGGAACCTGGGAGAAAAGGGGGTGGAATTCCCAGAGGAGGAACAGAAAGAAGATTACAAAAATTGTTTTGCACATTTCATTGATTTTGCAAAAGAAATGGGACAAGAGAAAGAGAACCACAACAGAAAGGGGCTCAGTAACTCCAAAGCTGATGCAGTGGGTGTTAATGCCAGCAAAGCTCAAGAAGATCTAGCCAAGGCTAGAAAACTGATCAAGAGCATGAGATCACTGGAGAAAAGTGCTTCCAAACCCTCACCATCTTCAACTGAGGATAACAGACCAAGACTTCATCAAATCGCATCACCCAAGAAAAGTACAGATAAAGGATCAGAGAGCATGAAGGAAGTTCCAGCCTATGCACGATTCCATGCCCTGGCTCAGCCCACCCCATCAGAGGCATCTCCTGCAACCTTACCCCTCCCGTATAAGTACAAGACTTTGGCTGAGATGTTCCGCTGCACTGACACAGTGTTGAATTTGTTGGGGCAGCGAAAAGAGAAGTGCACATTTCCAAAACTTAGGGATGCTGTACAACAGATGTCAAGGAAGCGGTTTGAGAAAAGGCATCTGGCACAAATGAAAACTGTGTATCCATTTGCTCTTGAATTCCGTCAAGACAAATGTCCTGGGAAGTCATCATCATTTGAGTTGAATGTAGAGTTTGGAAAAACAGAGGAATCTTGTAGTAAATTAACATTGACTGCTAGTGAGCTTCTGGCAAGGAAAGATACCTTTCAGAAAAATCTGCTGAAAATAACCAAGAAACACCATCAGGACTTCCTCTCCGACCTTAATCCACCCGTGTCAGTTAATGATGACAAGATCATGCGCTGGCATCCAAAGTTTCATCTTGACAATGTCCCAGATGTAGATGAAGCTGATCTGCCTCAGCCTCCAGTGGTGAAGACTTACAGCAGCGCACATGATGTGTTGGAAAAAGCACGGGACATGATGGCCCCAAGGGTTGAGAAAGCACTAAGAACAGTTGCTACAAAGGAACAAGCAGAAAAAGAGCAAAGAACAACAAGCAAGGACAACATGTCAGAAAAGAAAGATGCGACAAAGTTGATTGAAAATGCACAAAATAAGAACAACCTGAAGCATAAAACAGCCTTAAAGGGAATCTCACAAGATCTGCTGAACAAGATTCGCCAGAAAGAAGCAAAGAAAATAGAGGAAAGCATGACGAGAGATCCCGTAGTCGACAAGAAGCTTGCCATGAAGGAACGTCTTCCTGACCTGTGCAGAATACTCAAGGCTTACTTTTCTGCTGAACGCAAAGCAGCTATTCCTCTGGAGGATGCGACAGTGAAACTCTCGGAGAGCTACAAGGCCTCCCTATCTTCAGTACAAGTTGAAGAACACATCAGATTCATGTCACAGCTTGTTCCAGAATGGATCTCAGTTCTTACAGTAAGGAAATGTGCGTACGTCAAAATCAACAAGACTGCTGATGTGAACAATGTGATAAACAAACTTATGGCAAAAGAAATTCAATAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9I9A7	DNA replication factor Cdt1 OS=Xenopus laevis OX=8355 GN=cdt1 PE=1 SV=2
Q8R4E9	DNA replication factor Cdt1 OS=Mus musculus OX=10090 GN=Cdt1 PE=1 SV=1
Q9H211	DNA replication factor Cdt1 OS=Homo sapiens OX=9606 GN=CDT1 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0008039 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF08839 all species →	CDT1	DNA replication factor CDT1 like	Domain	Interproscan
PF16679 all species →	CDT1_C	DNA replication factor Cdt1 C-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR014939 all species →	Domain	CDT1 Geminin-binding domain-like	Interproscan
IPR032054 all species →	Domain	DNA replication factor Cdt1, C-terminal	Interproscan
IPR038090 all species →	Homologous_superfamily	DNA replication factor Cdt1, C-terminal WH domain superfamily	Interproscan
IPR045173 all species →	Family	DNA replication factor Cdt1	Interproscan
IPR036390 all species →	Homologous_superfamily	Winged helix DNA-binding domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR28637 all species →	DNA REPLICATION FACTOR CDT1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000076 all species →	Biological Process	DNA replication checkpoint signaling	Interproscan
GO:0000278 all species →	Biological Process	mitotic cell cycle	Interproscan
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0030174 all species →	Biological Process	regulation of DNA-templated DNA replication initiation	Interproscan
GO:0070182 all species →	Molecular Function	DNA polymerase binding	Interproscan
GO:0071163 all species →	Biological Process	DNA replication preinitiation complex assembly	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10727	CDT1; chromatin licensing and DNA replication factor 1	-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of evm.model.Ap4.6984 across 49 RNA-seq samples of Astrangia poculata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

49Samples

1TPM > 0

4Conditions

1,799.6Max TPM

36.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
whole organism · cold control	14	0	0.00	0.00
whole organism · heat control	12	0	0.00	0.00
whole organism · cold challenge	12	1	149.97	1,799.61
whole organism · heat challenge	11	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR10674714	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674715	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674724	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674733	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674734	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674735	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674736	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674737	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674739	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674743	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674746	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674747	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674748	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674750	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674706	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674707	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674708	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674717	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674718	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674720	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674721	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674725	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674731	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674741	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674752	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674753	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674744	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	1,799.61
SRR10674711	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674712	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674713	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674722	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674723	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674730	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674732	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674738	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674740	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674745	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674749	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674709	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674710	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674716	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674719	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674726	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674727	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674728	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674729	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674742	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674751	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674754	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00

Source: CnidoSite RNA-seq expression matrices (APOCU_TPM, StringTie quantification over 49 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.