Gene detail

Detailed information of evm.model.Ap5.1190.1.5f15e4c0 in Astrangia poculata

Genomic Location: Ap5:12948638...12989364
NR annotation: KAJ7379527.1, Isoleucine--tRNA ligase, cytoplasmic [Desmophyllum pertusum]
Species Astrangia poculata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

evm.model.Ap5.1190.1.5f15e4c0

atgtggaagttcctttctggaaaaagcaacatatatttgttaaacactcgcaaatttgtcaaccctaaatttttaccatttcgagccttttgcacatttggtcataacgactcgtccccaatggccgctggagctgctgagtaccatgattttccgaaagaggaagagaatattttgaagctttgggaaaagttagatgcgttccagtcttgtttgcgccagtcaaaggacagaccaaggtacagtttttatgatggacctccatttgccactggcttgcctcattatggacacatccttgctggtactataaaggacatagttacaagatttgctcatcagtctggttatcatgttgagaggcgttttggatgggactgtcatggtcttccagtggaatatgaaattgatcagaagctgggtatcaagagtccagatgatgttgcaaaaatgggaatagctaactacaaccaagagtgccgacagattgtgatgcgctattctaatgaatgggagtttattgtcaagaggatgggacgatggattgattttgacaatgactacaagacactatatccctggtttatggagtctgtttggtggacattccaacagctgtttaacaaagggctagtctacaggggtttcaaggttatgccatattctacaagatgtagtactccattgtcaaactttgaatccaaccagaactacaaagaaactatggatccatcagttattgtgaactttcctttggatgagaatcctgatgtcagcatgattgcctggacaacaacaccctggactctcccaagtaaccttgctcttgttgtaaaccctgacatggactatgtcaaagttaaagacaattgcactaacagtgtttatatcatgatggaagttagactggaagctctgtttaaaaagtcagacgagtacactattctggaaagatttaaaggagctagcctggaaggaaaggcttacaaaccgctcttcacttactttcaggatatgaagtctgatggcgctttcagggtgctagttgatagttatgtgacaggtgaaagtggcactggggtcgttcattctgcaccagcctttggagaggatgattaccgggtgtgtttggccagtggaattctacaaaaaggtggtaaactaccttgtcctgtagatgctagtggagtgtttactagtcaagtgtcagatttcaaaggacagtatgtcaaggatgctgataagaacataatgaaatggctcaagcagcagcagagattagttcaccaaagtacccataaacatagctatccgttctgctggaggtcagacacaccattgatttacaaagcagttcctggttggttcattcaggtggaatctatcgttgacaagcttttaaccaataacaagaagtcttactgggtaccagaatttgtgcaggagaagcgttttcacaactggcttgaaagtgcacatgactggaatgtgtcaaggaatcgttactggggtacaccaattcctctgtgggtcagtgacgattatcaagaggtcgtgtgtgttggatccattgatgaattagaacagttatcaggagtcagagttaaggatcttcacagagagagcgtggaccacatcacaatcccatccaaaacaaacaggggagttctcaaaagggtccctgaagtgtttgactgctggtttgaaagtggaagtatgccttatgcacaggcccactacccatttgaaaataaaaaggaatttgaagcatcatttccagctgatttcattgctgaaggaattgaccagactagaggatggttttataccctgctggtgatttcaacagctttgtttgataagccaccattcaagaatctcattgtcaatggactagttcttgctgcggatggagcaaagatgagtaagagaaagaagaactatcctgatccaatggagattgttaccaagtatggagctgacgctttgaggttgtacctgatcaactctcctgtagtcagggctgaaactctcaagttccaagagaaaggagtcaaggatatcattaaagatgtgtttctgccttggtataatgctcacagattccttttacagaacattcaacagatggagagggaaggacagaagttttttcatgatgaagcagttttgttgaagttggggaacacacttgatcgttggattctctcctttactcagagtttggtgttgtttgtcaacaaagaaatggctgcttatcatctgtacactgttgttccacgtcttgtcaagttcattgactatctgaccaatgtgtatgtgcgaatgaacaggaagcggctcaggggagactgtggagacattgatcgtcaggaggcgcttcagacgctgttcagtgtcatcttttccatgatacgattaatggcatcattcactccatttctcacagagcacacttaccaggcattacgaccttacgtaccagaaagtatgaagtctggagaaacagagagtattcattacctgatgatcccacaggccagggaaaatttgatcgatgaagagattgagaggagagtagcgctgatgcaaactgtaattgagcttggtcgagttgtcagagaaagaaaaactctgccattaaagtatcctctccctgagctcgtcgtcattcaccagcaacaacagagccttaatgatgtgctatctcttgaaaactacatcaaacaagagctgaatgtgagaaaagtaactgtgtcttcggataaacacaagtttggtgtgcaattaagggctgagcctaacaaccaggccttagggcgaaggctgaagggtgcattcaaacaagtcttgcaggcaatcagagatctttcagacaaggaagtacaagtttatcaggaaaagggagagttaatggtagccggtcatttgctctctggaacagatttaaaggtcatgtactcatttgatcagactgattcaactccgtctgcgtatgaagcacattcggatggtgaggtgctgattctgttagatgtcactccggatgaatcgatgctttctgagggtgtggcacgagaagttgtcaatcgtattcagaaactacgaaaaaaggcacagctacaacctaatgatgacatcactattgtatttgaagtcacacaaggtgcacaagaggccgttaacgctttgaatgacgtcataggcgtacacaaaggatacatcgaagatagtgtcaaacagcctgtcgtgcccagctcccactcgcctaaacttcctttgataatcagcgagaaaacagaggtgaaaggtagcatgcttgatctgaagctgttacgaggccaccagacacaagacaatgacgacataacatcaggagaaccagcgtgtaggtttgtcaatgtacagctgtgcggagtggcccagactctcaagggaactgttctgctagagaatccccgcgggacttcaattattacacttgatcagcttgtgcgacaggtagccataatgtttaatgaacaggagaatgttttaaaactgtctgtgtcagcagcgtgtgactcaggtgagcccaacatacacagctttctttattaa

Transcript

evm.model.Ap5.1190.1.5f15e4c0

ATGTGGAAGTTCCTTTCTGGAAAAAGCAACATATATTTGTTAAACACTCGCAAATTTGTCAACCCTAAATTTTTACCATTTCGAGCCTTTTGCACATTTGGTCATAACGACTCGTCCCCAATGGCCGCTGGAGCTGCTGAGTACCATGATTTTCCGAAAGAGGAAGAGAATATTTTGAAGCTTTGGGAAAAGTTAGATGCGTTCCAGTCTTGTTTGCGCCAGTCAAAGGACAGACCAAGGTACAGTTTTTATGATGGACCTCCATTTGCCACTGGCTTGCCTCATTATGGACACATCCTTGCTGGTACTATAAAGGACATAGTTACAAGATTTGCTCATCAGTCTGGTTATCATGTTGAGAGGCGTTTTGGATGGGACTGTCATGGTCTTCCAGTGGAATATGAAATTGATCAGAAGCTGGGTATCAAGAGTCCAGATGATGTTGCAAAAATGGGAATAGCTAACTACAACCAAGAGTGCCGACAGATTGTGATGCGCTATTCTAATGAATGGGAGTTTATTGTCAAGAGGATGGGACGATGGATTGATTTTGACAATGACTACAAGACACTATATCCCTGGTTTATGGAGTCTGTTTGGTGGACATTCCAACAGCTGTTTAACAAAGGGCTAGTCTACAGGGGTTTCAAGGTTATGCCATATTCTACAAGATGTAGTACTCCATTGTCAAACTTTGAATCCAACCAGAACTACAAAGAAACTATGGATCCATCAGTTATTGTGAACTTTCCTTTGGATGAGAATCCTGATGTCAGCATGATTGCCTGGACAACAACACCCTGGACTCTCCCAAGTAACCTTGCTCTTGTTGTAAACCCTGACATGGACTATGTCAAAGTTAAAGACAATTGCACTAACAGTGTTTATATCATGATGGAAGTTAGACTGGAAGCTCTGTTTAAAAAGTCAGACGAGTACACTATTCTGGAAAGATTTAAAGGAGCTAGCCTGGAAGGAAAGGCTTACAAACCGCTCTTCACTTACTTTCAGGATATGAAGTCTGATGGCGCTTTCAGGGTGCTAGTTGATAGTTATGTGACAGGTGAAAGTGGCACTGGGGTCGTTCATTCTGCACCAGCCTTTGGAGAGGATGATTACCGGGTGTGTTTGGCCAGTGGAATTCTACAAAAAGGTGGTAAACTACCTTGTCCTGTAGATGCTAGTGGAGTGTTTACTAGTCAAGTGTCAGATTTCAAAGGACAGTATGTCAAGGATGCTGATAAGAACATAATGAAATGGCTCAAGCAGCAGCAGAGATTAGTTCACCAAAGTACCCATAAACATAGCTATCCGTTCTGCTGGAGGTCAGACACACCATTGATTTACAAAGCAGTTCCTGGTTGGTTCATTCAGGTGGAATCTATCGTTGACAAGCTTTTAACCAATAACAAGAAGTCTTACTGGGTACCAGAATTTGTGCAGGAGAAGCGTTTTCACAACTGGCTTGAAAGTGCACATGACTGGAATGTGTCAAGGAATCGTTACTGGGGTACACCAATTCCTCTGTGGGTCAGTGACGATTATCAAGAGGTCGTGTGTGTTGGATCCATTGATGAATTAGAACAGTTATCAGGAGTCAGAGTTAAGGATCTTCACAGAGAGAGCGTGGACCACATCACAATCCCATCCAAAACAAACAGGGGAGTTCTCAAAAGGGTCCCTGAAGTGTTTGACTGCTGGTTTGAAAGTGGAAGTATGCCTTATGCACAGGCCCACTACCCATTTGAAAATAAAAAGGAATTTGAAGCATCATTTCCAGCTGATTTCATTGCTGAAGGAATTGACCAGACTAGAGGATGGTTTTATACCCTGCTGGTGATTTCAACAGCTTTGTTTGATAAGCCACCATTCAAGAATCTCATTGTCAATGGACTAGTTCTTGCTGCGGATGGAGCAAAGATGAGTAAGAGAAAGAAGAACTATCCTGATCCAATGGAGATTGTTACCAAGTATGGAGCTGACGCTTTGAGGTTGTACCTGATCAACTCTCCTGTAGTCAGGGCTGAAACTCTCAAGTTCCAAGAGAAAGGAGTCAAGGATATCATTAAAGATGTGTTTCTGCCTTGGTATAATGCTCACAGATTCCTTTTACAGAACATTCAACAGATGGAGAGGGAAGGACAGAAGTTTTTTCATGATGAAGCAGTTTTGTTGAAGTTGGGGAACACACTTGATCGTTGGATTCTCTCCTTTACTCAGAGTTTGGTGTTGTTTGTCAACAAAGAAATGGCTGCTTATCATCTGTACACTGTTGTTCCACGTCTTGTCAAGTTCATTGACTATCTGACCAATGTGTATGTGCGAATGAACAGGAAGCGGCTCAGGGGAGACTGTGGAGACATTGATCGTCAGGAGGCGCTTCAGACGCTGTTCAGTGTCATCTTTTCCATGATACGATTAATGGCATCATTCACTCCATTTCTCACAGAGCACACTTACCAGGCATTACGACCTTACGTACCAGAAAGTATGAAGTCTGGAGAAACAGAGAGTATTCATTACCTGATGATCCCACAGGCCAGGGAAAATTTGATCGATGAAGAGATTGAGAGGAGAGTAGCGCTGATGCAAACTGTAATTGAGCTTGGTCGAGTTGTCAGAGAAAGAAAAACTCTGCCATTAAAGTATCCTCTCCCTGAGCTCGTCGTCATTCACCAGCAACAACAGAGCCTTAATGATGTGCTATCTCTTGAAAACTACATCAAACAAGAGCTGAATGTGAGAAAAGTAACTGTGTCTTCGGATAAACACAAGTTTGGTGTGCAATTAAGGGCTGAGCCTAACAACCAGGCCTTAGGGCGAAGGCTGAAGGGTGCATTCAAACAAGTCTTGCAGGCAATCAGAGATCTTTCAGACAAGGAAGTACAAGTTTATCAGGAAAAGGGAGAGTTAATGGTAGCCGGTCATTTGCTCTCTGGAACAGATTTAAAGGTCATGTACTCATTTGATCAGACTGATTCAACTCCGTCTGCGTATGAAGCACATTCGGATGGTGAGGTGCTGATTCTGTTAGATGTCACTCCGGATGAATCGATGCTTTCTGAGGGTGTGGCACGAGAAGTTGTCAATCGTATTCAGAAACTACGAAAAAAGGCACAGCTACAACCTAATGATGACATCACTATTGTATTTGAAGTCACACAAGGTGCACAAGAGGCCGTTAACGCTTTGAATGACGTCATAGGCGTACACAAAGGATACATCGAAGATAGTGTCAAACAGCCTGTCGTGCCCAGCTCCCACTCGCCTAAACTTCCTTTGATAATCAGCGAGAAAACAGAGGTGAAAGGTAGCATGCTTGATCTGAAGCTGTTACGAGGCCACCAGACACAAGACAATGACGACATAACATCAGGAGAACCAGCGTGTAGGTTTGTCAATGTACAGCTGTGCGGAGTGGCCCAGACTCTCAAGGGAACTGTTCTGCTAGAGAATCCCCGCGGGACTTCAATTATTACACTTGATCAGCTTGTGCGACAGGTAGCCATAATGTTTAATGAACAGGAGAATGTTTTAAAACTGTCTGTGTCAGCAGCGTGTGACTCAGGTGAGCCCAACATACACAGCTTTCTTTATTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P41252	Isoleucine--tRNA ligase, cytoplasmic OS=Homo sapiens OX=9606 GN=IARS1 PE=1 SV=2
Q8BU30	Isoleucine--tRNA ligase, cytoplasmic OS=Mus musculus OX=10090 GN=Iars1 PE=1 SV=2
Q21926	Isoleucine--tRNA ligase, cytoplasmic OS=Caenorhabditis elegans OX=6239 GN=iars-1 PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002633 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00133 all species →	tRNA-synt_1	tRNA synthetases class I (I, L, M and V)	Domain	Interproscan
PF19302 all species →	DUF5915	Domain of unknown function (DUF5915)	Domain	Interproscan
PF08264 all species →	Anticodon_1	Anticodon-binding domain of tRNA ligase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002300 all species →	Domain	Aminoacyl-tRNA synthetase, class Ia	Interproscan
IPR033709 all species →	Domain	Isoleucyl tRNA synthetase type 2, anticodon-binding domain	Interproscan
IPR014729 all species →	Homologous_superfamily	Rossmann-like alpha/beta/alpha sandwich fold	Interproscan
IPR001412 all species →	Conserved_site	Aminoacyl-tRNA synthetase, class I, conserved site	Interproscan
IPR002301 all species →	Family	Isoleucine-tRNA ligase	Interproscan
IPR009080 all species →	Homologous_superfamily	Aminoacyl-tRNA synthetase, class Ia, anticodon-binding	Interproscan
IPR013155 all species →	Domain	Methionyl/Valyl/Leucyl/Isoleucyl-tRNA synthetase, anticodon-binding	Interproscan
IPR009008 all species →	Homologous_superfamily	Valyl/Leucyl/Isoleucyl-tRNA synthetase, editing domain	Interproscan
IPR023586 all species →	Family	Isoleucine-tRNA ligase, type 2	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR42780 all species →	SOLEUCYL-TRNA SYNTHETASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000166 all species →	Molecular Function	nucleotide binding	Interproscan
GO:0004812 all species →	Molecular Function	aminoacyl-tRNA ligase activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0006418 all species →	Biological Process	tRNA aminoacylation for protein translation	Interproscan
GO:0000049 all species →	Molecular Function	tRNA binding	Interproscan
GO:0004822 all species →	Molecular Function	isoleucine-tRNA ligase activity	Interproscan
GO:0006428 all species →	Biological Process	isoleucyl-tRNA aminoacylation	Interproscan
GO:0002161 all species →	Molecular Function	aminoacyl-tRNA editing activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01870	IARS, ileS; isoleucyl-tRNA synthetase	EC:6.1.1.5	Transfer RNA biogenesis	ko03016	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of evm.model.Ap5.1190.1.5f15e4c0 across 49 RNA-seq samples of Astrangia poculata. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

49Samples

0TPM > 0

4Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole organism · cold control	14	0	0.00	0.00
whole organism · heat control	12	0	0.00	0.00
whole organism · cold challenge	12	0	0.00	0.00
whole organism · heat challenge	11	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR10674714	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674715	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674724	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674733	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674734	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674735	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674736	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674737	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674739	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674743	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674746	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674747	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674748	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674750	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674706	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674707	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674708	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674717	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674718	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674720	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674721	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674725	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674731	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674741	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674752	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674753	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674711	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674712	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674713	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674722	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674723	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674730	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674732	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674738	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674740	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674744	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674745	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674749	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674709	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674710	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674716	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674719	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674726	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674727	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674728	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674729	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674742	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674751	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674754	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293

Source: CnidoSite RNA-seq expression matrices (APOCU_TPM, StringTie quantification over 49 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.