Gene detail

Detailed information of evm.model.Ap6.2405 in Astrangia poculata

Genomic Location: Ap6:23747439...23763999
NR annotation: XP_020624373.1, probable serine/threonine-protein kinase DDB_G0268876 isoform X1 [Orbicella faveolata]
Species Astrangia poculata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

evm.model.Ap6.2405

atggatgaggaagacgatttacagcccgattcccctccaggatttgtggaagaaattgacagcactgaactggagataacagagacagttggaaggggtgcatttggagttgtttcaaaggcaatatggagaaaaaagtttgttgttgctgtaaagactattgagactgaggcagaaaagaaagctttcattgtggaggtacaacagctgtctcgcattagccatgagaacatcatcaagctttatggcgcatgtacaacacaggatccagtgtgccttgtcatggagtacgcagaaggtggctctctctatagtctacttcactggacacacccagtgcgacgggcaccaatctacacagcttcccatgtaatgagctgggctctgcagtgtgcaagaggtgttgaatatttacatggtgtcaaacccaaaggaattattcacagagaccttaagcctccaaacttgttgctgacaaagtgtggaactgttctaaagatctgtgattttggaacagcttgtgacatgaaaacatacatgacaaacaacaaaggaagtgcagcgtggatggctcctgaagtgtttgaaggtaacaattacacagagaagtgtgatgtcttcagttttggtataattctttgggagatgatatctcgtcgcaagccatatgaagatatgcaagggttcaatgcattcagaatcatgtgggctgtacacaatggaaccaggcctcctttaatagcagatattccaaaaccaattgaagatttgatgacaagctgctgggataaggaaccttccaagaggccttcattcacaagaattgctcacatacttcagcatttagtacagttctttccaggagctgatacttgccttgtcttccctgttgcttcatcaagtaccagttcagatgaaggcactaccagctcaggcatgtcatttctgagtcctgaactgggtgatcgggaaatgtccacacagggcagcacactgagtgacacagttattggagtgaagagccagccatccagtgagagtgatgaagaaggttcatatgaagttgatgaagaagataaggaggaagacgaaactcccgtgccagaagaatttgaaaatgaaccacctatggatgaagcagctgggagtccccccggtccagcatctccaactataactttttctgttgataataaaagtccaacagcccagttccttcgacagccatctgactcaggcagttctccgtcgtccagtcaaaagtcaggaaaagttcctgctcctcgaccaattagccccattcctggacccatacctggaccaccccctggtataaatttccagccaattaaaatcgtttctgcctcatcttctcctaactcaaattccagtctgacgaccacccctccaccgtctgaagcgagcccagtgaaggcttccagtccaagaatttcccttcaacaaccagtgaaccctgcacgtccagcaagtcctgccatggttagttctgggttctacccaaattactctgcagatcttcaaccaagtgcagggatgcatcaaccaccttattactcagctgcgggttatatatcaacaacaccatccgtaggacctgggcaacctcttatctactctgaggcggcaggaccttctggttatctagttagtgcgacacccccttacagaactcccagtcctattcctttgaattacggccagcagggtgtttaccaaccaaacacaatgtacccaccagtctctacctatggcttccctgtgtccaccactagtccaatgcaaatgccaacaccaagtactgttccttcagtacccagaaatactcctgtgtctggctttcacaggccacctggtgacggcctggatctggaagagctgcgacaggcccttcagaatgatcttgagcctccagagcacggcaacagggtgcgcatgaactccagtggtcatgcaacacctccgcaaggattgcacaatgcaggttctggattctccagtcaatccagctcgggaaaagggagtccttaccctgatagaaaggccagctggccagtgtctggcccacgcatgcacaacccgccccatcccatgaacagatcggtgtcatctccagaacgaaagtacagtggagagagacacagcccactgccgaggagacatgagctagataacacagcattcccaagcatttatcaagccttagatactcatttacagccgattgcgccaaacccttcaattccagagtcgcaggcaatctatgatgaacatatcaggcttgccaaagagtacatacaagttcagacagaaatggcagtgattctccaaaagaagcttgaacgggagagagatttacaagaataccagtcagagcaacaagttaatgcccaatatgtggaggagtttgcaatgctgaccagtgaaaaggaaaatcttctgttgcttcacaagaatctcaagtcacacctggagggtatgaaacggccaccaggtacactgcagacgcaacacagccatcctatgggtcctatgggccaatttcgatga

Transcript

evm.model.Ap6.2405

ATGGATGAGGAAGACGATTTACAGCCCGATTCCCCTCCAGGATTTGTGGAAGAAATTGACAGCACTGAACTGGAGATAACAGAGACAGTTGGAAGGGGTGCATTTGGAGTTGTTTCAAAGGCAATATGGAGAAAAAAGTTTGTTGTTGCTGTAAAGACTATTGAGACTGAGGCAGAAAAGAAAGCTTTCATTGTGGAGGTACAACAGCTGTCTCGCATTAGCCATGAGAACATCATCAAGCTTTATGGCGCATGTACAACACAGGATCCAGTGTGCCTTGTCATGGAGTACGCAGAAGGTGGCTCTCTCTATAGTCTACTTCACTGGACACACCCAGTGCGACGGGCACCAATCTACACAGCTTCCCATGTAATGAGCTGGGCTCTGCAGTGTGCAAGAGGTGTTGAATATTTACATGGTGTCAAACCCAAAGGAATTATTCACAGAGACCTTAAGCCTCCAAACTTGTTGCTGACAAAGTGTGGAACTGTTCTAAAGATCTGTGATTTTGGAACAGCTTGTGACATGAAAACATACATGACAAACAACAAAGGAAGTGCAGCGTGGATGGCTCCTGAAGTGTTTGAAGGTAACAATTACACAGAGAAGTGTGATGTCTTCAGTTTTGGTATAATTCTTTGGGAGATGATATCTCGTCGCAAGCCATATGAAGATATGCAAGGGTTCAATGCATTCAGAATCATGTGGGCTGTACACAATGGAACCAGGCCTCCTTTAATAGCAGATATTCCAAAACCAATTGAAGATTTGATGACAAGCTGCTGGGATAAGGAACCTTCCAAGAGGCCTTCATTCACAAGAATTGCTCACATACTTCAGCATTTAGTACAGTTCTTTCCAGGAGCTGATACTTGCCTTGTCTTCCCTGTTGCTTCATCAAGTACCAGTTCAGATGAAGGCACTACCAGCTCAGGCATGTCATTTCTGAGTCCTGAACTGGGTGATCGGGAAATGTCCACACAGGGCAGCACACTGAGTGACACAGTTATTGGAGTGAAGAGCCAGCCATCCAGTGAGAGTGATGAAGAAGGTTCATATGAAGTTGATGAAGAAGATAAGGAGGAAGACGAAACTCCCGTGCCAGAAGAATTTGAAAATGAACCACCTATGGATGAAGCAGCTGGGAGTCCCCCCGGTCCAGCATCTCCAACTATAACTTTTTCTGTTGATAATAAAAGTCCAACAGCCCAGTTCCTTCGACAGCCATCTGACTCAGGCAGTTCTCCGTCGTCCAGTCAAAAGTCAGGAAAAGTTCCTGCTCCTCGACCAATTAGCCCCATTCCTGGACCCATACCTGGACCACCCCCTGGTATAAATTTCCAGCCAATTAAAATCGTTTCTGCCTCATCTTCTCCTAACTCAAATTCCAGTCTGACGACCACCCCTCCACCGTCTGAAGCGAGCCCAGTGAAGGCTTCCAGTCCAAGAATTTCCCTTCAACAACCAGTGAACCCTGCACGTCCAGCAAGTCCTGCCATGGTTAGTTCTGGGTTCTACCCAAATTACTCTGCAGATCTTCAACCAAGTGCAGGGATGCATCAACCACCTTATTACTCAGCTGCGGGTTATATATCAACAACACCATCCGTAGGACCTGGGCAACCTCTTATCTACTCTGAGGCGGCAGGACCTTCTGGTTATCTAGTTAGTGCGACACCCCCTTACAGAACTCCCAGTCCTATTCCTTTGAATTACGGCCAGCAGGGTGTTTACCAACCAAACACAATGTACCCACCAGTCTCTACCTATGGCTTCCCTGTGTCCACCACTAGTCCAATGCAAATGCCAACACCAAGTACTGTTCCTTCAGTACCCAGAAATACTCCTGTGTCTGGCTTTCACAGGCCACCTGGTGACGGCCTGGATCTGGAAGAGCTGCGACAGGCCCTTCAGAATGATCTTGAGCCTCCAGAGCACGGCAACAGGGTGCGCATGAACTCCAGTGGTCATGCAACACCTCCGCAAGGATTGCACAATGCAGGTTCTGGATTCTCCAGTCAATCCAGCTCGGGAAAAGGGAGTCCTTACCCTGATAGAAAGGCCAGCTGGCCAGTGTCTGGCCCACGCATGCACAACCCGCCCCATCCCATGAACAGATCGGTGTCATCTCCAGAACGAAAGTACAGTGGAGAGAGACACAGCCCACTGCCGAGGAGACATGAGCTAGATAACACAGCATTCCCAAGCATTTATCAAGCCTTAGATACTCATTTACAGCCGATTGCGCCAAACCCTTCAATTCCAGAGTCGCAGGCAATCTATGATGAACATATCAGGCTTGCCAAAGAGTACATACAAGTTCAGACAGAAATGGCAGTGATTCTCCAAAAGAAGCTTGAACGGGAGAGAGATTTACAAGAATACCAGTCAGAGCAACAAGTTAATGCCCAATATGTGGAGGAGTTTGCAATGCTGACCAGTGAAAAGGAAAATCTTCTGTTGCTTCACAAGAATCTCAAGTCACACCTGGAGGGTATGAAACGGCCACCAGGTACACTGCAGACGCAACACAGCCATCCTATGGGTCCTATGGGCCAATTTCGATGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A2VDU3	Mitogen-activated protein kinase kinase kinase 7 OS=Bos taurus OX=9913 GN=MAP3K7 PE=2 SV=1
Q62073	Mitogen-activated protein kinase kinase kinase 7 OS=Mus musculus OX=10090 GN=Map3k7 PE=1 SV=1
O43318	Mitogen-activated protein kinase kinase kinase 7 OS=Homo sapiens OX=9606 GN=MAP3K7 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003270 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF07714 all species →	PK_Tyr_Ser-Thr	Protein tyrosine and serine/threonine kinase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001245 all species →	Domain	Serine-threonine/tyrosine-protein kinase, catalytic domain	Interproscan
IPR017421 all species →	Family	Mitogen-activated protein (MAP) kinase kinase kinase 7-like	Interproscan
IPR011009 all species →	Homologous_superfamily	Protein kinase-like domain superfamily	Interproscan
IPR000719 all species →	Domain	Protein kinase domain	Interproscan
IPR008271 all species →	Active_site	Serine/threonine-protein kinase, active site	Interproscan
IPR017441 all species →	Binding_site	Protein kinase, ATP binding site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46716 all species →	MITOGEN-ACTIVATED PROTEIN KINASE KINASE KINASE 7	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004672 all species →	Molecular Function	protein kinase activity	Interproscan
GO:0006468 all species →	Biological Process	protein phosphorylation	Interproscan
GO:0000287 all species →	Molecular Function	magnesium ion binding	Interproscan
GO:0004709 all species →	Molecular Function	MAP kinase kinase kinase activity	Interproscan
GO:0007165 all species →	Biological Process	signal transduction	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K04427	MAP3K7, TAK1; mitogen-activated protein kinase kinase kinase 7	EC:2.7.11.25	Protein kinases	ko01001	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of evm.model.Ap6.2405 across 49 RNA-seq samples of Astrangia poculata. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

49Samples

0TPM > 0

4Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole organism · cold control	14	0	0.00	0.00
whole organism · heat control	12	0	0.00	0.00
whole organism · cold challenge	12	0	0.00	0.00
whole organism · heat challenge	11	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR10674714	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674715	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674724	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674733	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674734	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674735	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674736	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674737	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674739	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674743	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674746	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674747	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674748	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674750	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674706	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674707	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674708	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674717	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674718	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674720	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674721	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674725	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674731	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674741	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674752	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674753	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674711	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674712	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674713	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674722	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674723	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674730	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674732	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674738	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674740	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674744	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674745	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674749	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674709	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674710	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674716	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674719	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674726	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674727	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674728	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674729	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674742	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674751	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674754	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293

Source: CnidoSite RNA-seq expression matrices (APOCU_TPM, StringTie quantification over 49 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.