Gene detail

Detailed information of evm.model.Ap6.483 in Astrangia poculata

Genomic Location: Ap6:4362530...4385876
NR annotation: KAJ7393218.1, Ubiquitin carboxyl-terminal hydrolase 48 [Desmophyllum pertusum]
Species Astrangia poculata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

evm.model.Ap6.483

atggcgcgtcgaacaacaaatcgaaaacatcagggaaatgttctaaagcaagcttgggaatgggctgatcacaccgaacctgaaaacatcacaagcgaaaacatcgagagtgtctaccggataaatgcaagtgtttgttcccagggagattgtaggaggaactgtaaagccaatcctaactgtttcaattgccttggagaaagattttggctaggcgaaataaaagatgattactggttacattgtgaagatccagaaaaagaaagaagacctgagaatgcttttgttggcctcaagaaccttggagccacatgctatgtgaatacatttctacaggtctggtttcataatccagtgtttcgctcagccatgtacaaatatatctctcctacgattcctggacataaacctaaacaagaggatacatctaacaaatctgtgaatggtgtgccaacagcagagattggtacaaacagcacagattctcctgaaatttcaaaccacaaaagccaggatgaccaaggcttgaacaaaccttctgctgtagctgtaacacctgataaagcatcagctgtacagcaggttccattacttccatctaccactgtgctaagctcagaggaagcgccaactactgtctgtggccatcttcagttgctgtttgctcagttgcagtacagtattcgaaggtacattgatccaagcccatttgttgacagtctaggattggacacggcacaacagcaggatgcacaggagtttagcaaactttttacctctttactggaagaaacattttcacaacaggctgaacccgagatacaggacattgttcaatctcagtttggtggagaatacttttacgtcacagaatgtcacagctgtggaaacaaatcaaagaggctttctcggttttatgaactggatctgaacatacaaggacacacctcactcaaccagtgcatcaaggaatttttaaaggaagaaaagttggatggtgataatcagtactactgcactcagtgtaacagtaaacagaatgctgctcgttacattgaacttcactccctgcctccagttctcaacctgcaactgttacgatttgtgtttgacaggaaaactggctacaagaagaaactgaactcattcattcagtttcctgatattcttgatatgaaggaccatgtgaagaatggttgcattggatctgactcagtttatgagctgagtgcagtgttgattcactttggcgtgagtgcttattctggacactatgtggctcacatcagagataaaaagtcaggttcatggtacaagtttaatgatgaagatattgtcaagatgcaggggaagttaaaactgtcacaggatgaagattctgcagatactagcattaagccagccaaaaggcccaaatgtgcaaagggttatcatgtgtcgaagaatgcatacacattggtgtacaccctccaaggacataagggtgtggggagtgaagatgatgatgttgaagttccacctcatgtgcaagagttggtggcgatggacaatagtcgatttgaacactgggttacagaggttaaagcatttcgggaaatgttggtcgccttgggacgggcaagacaggctgaaataaaaaaattatatcaagacatgtcagtcacttcagaaacagagtatgaatggatttcttcaaaatggctgaaagattggatgaatgagaaaattcaaacgccgccagtggacaattcctcactgctatgttctcatgggaaactcaacccaaatcaagttctttatgcgaagagagtcaacatcaaagctgcagacgaaattttcagaaattatggtggattgccaagacttcaaagtgactcgatgtgtgtcaactgtgtgaaagaacaatgcagaagaatacgatttgagtccaggctggctgaagattacaagtttgtgtccgatgctttgaagtctcaaacatcgaacagtgagaagtactttttggtcggtcgacgatcgcttctgagatggaaagctttggcaaactactatgaagagatgcgacagagtttgatggacagctgtcaagttacagccaatcacgacgtggaggacgaagacgacgctaacgctagtagaaatgaaaacaatgatgtaagcatgacagaagaggagaacgcaactgagcaggctgacaagaatgtacaggaaaatggcgctgaggaggacgaaaatgatagcgattctaagttcaacgaagacttgctttgtgaacacggggacctttcttcggacgagtcatgtcggaggcttgtgccagatgtcgtgtggaagaggttaaaatattactttccttcctcgcccgagtttgcagcttctcaagcagtgtgtcgatcgtgtcaggcagaagacgaagaggagcgacaaaagactgagacgtataaattactagcatcggaacagagagctgccgttagtcaactgtatctcgacaggaatcggccctcgtttaataacagtgacccgttcgtcgcctgtgctatttcgaaagattttcttgatcagtggaggcagttcttgaggtacccagtaaagaatgtcccaccaaagagtatcgtcaatgctcctctcctgtgccctcatgaaaaattcctcttcaatcctgagtgcgaggatgacatggatggtgcgagccaagagttatgttatgtttggcaacacgagtggaacacgcttacccagtcctacccgtacgatcacgtgatcagcgtcaccaaaaatgtaaccgaagacgatgttcgagaacttgtgacaagtcccgaagtgtgcacggaatgctgttttgcgcggatacaggaaagagcccaacacgtggagaattatcgttacggtacaatcttcgtgcggaaaataacaaaggaccacagcgagaaggacatacagcaagccttgaatgatagtacctcgagtaaagacggtgattcgtattcgttcgacccagacttccagacaccaccggacagtaagaaaccaaagctaaaccgtgattctcgagcccgtcgaagttcaaggcaccgtaaacagcgcggagaagtctctttgactgttggatcaacagagactttaagagatgttaaactgcagctaatgaaaagcttttcggtgatgccaatggatcaacatctcacgttaaatggtgtcacgctctccaataatgaagccactctcctttctttgggaatcaagccaggatctttattactactacagattgatgaacctcaaggggccatctcacaggacgctcttccagtgagcaacgcccccgaagaaggtttcaaaggaactggtttacttggtcactcgtaa

Transcript

evm.model.Ap6.483

AAGATGGCGCGTCGAACAACAAATCGAAAACATCAGGGAAATGTTCTAAAGCAAGCTTGGGAATGGGCTGATCACACCGAACCTGAAAACATCACAAGCGAAAACATCGAGAGTGTCTACCGGATAAATGCAAGTGTTTGTTCCCAGGGAGATTGTAGGAGGAACTGTAAAGCCAATCCTAACTGTTTCAATTGCCTTGGAGAAAGATTTTGGCTAGGCGAAATAAAAGATGATTACTGGTTACATTGTGAAGATCCAGAAAAAGAAAGAAGACCTGAGAATGCTTTTGTTGGCCTCAAGAACCTTGGAGCCACATGCTATGTGAATACATTTCTACAGGTCTGGTTTCATAATCCAGTGTTTCGCTCAGCCATGTACAAATATATCTCTCCTACGATTCCTGGACATAAACCTAAACAAGAGGATACATCTAACAAATCTGTGAATGGTGTGCCAACAGCAGAGATTGGTACAAACAGCACAGATTCTCCTGAAATTTCAAACCACAAAAGCCAGGATGACCAAGGCTTGAACAAACCTTCTGCTGTAGCTGTAACACCTGATAAAGCATCAGCTGTACAGCAGGTTCCATTACTTCCATCTACCACTGTGCTAAGCTCAGAGGAAGCGCCAACTACTGTCTGTGGCCATCTTCAGTTGCTGTTTGCTCAGTTGCAGTACAGTATTCGAAGGTACATTGATCCAAGCCCATTTGTTGACAGTCTAGGATTGGACACGGCACAACAGCAGGATGCACAGGAGTTTAGCAAACTTTTTACCTCTTTACTGGAAGAAACATTTTCACAACAGGCTGAACCCGAGATACAGGACATTGTTCAATCTCAGTTTGGTGGAGAATACTTTTACGTCACAGAATGTCACAGCTGTGGAAACAAATCAAAGAGGCTTTCTCGGTTTTATGAACTGGATCTGAACATACAAGGACACACCTCACTCAACCAGTGCATCAAGGAATTTTTAAAGGAAGAAAAGTTGGATGGTGATAATCAGTACTACTGCACTCAGTGTAACAGTAAACAGAATGCTGCTCGTTACATTGAACTTCACTCCCTGCCTCCAGTTCTCAACCTGCAACTGTTACGATTTGTGTTTGACAGGAAAACTGGCTACAAGAAGAAACTGAACTCATTCATTCAGTTTCCTGATATTCTTGATATGAAGGACCATGTGAAGAATGGTTGCATTGGATCTGACTCAGTTTATGAGCTGAGTGCAGTGTTGATTCACTTTGGCGTGAGTGCTTATTCTGGACACTATGTGGCTCACATCAGAGATAAAAAGTCAGGTTCATGGTACAAGTTTAATGATGAAGATATTGTCAAGATGCAGGGGAAGTTAAAACTGTCACAGGATGAAGATTCTGCAGATACTAGCATTAAGCCAGCCAAAAGGCCCAAATGTGCAAAGGGTTATCATGTGTCGAAGAATGCATACACATTGGTGTACACCCTCCAAGGACATAAGGGTGTGGGGAGTGAAGATGATGATGTTGAAGTTCCACCTCATGTGCAAGAGTTGGTGGCGATGGACAATAGTCGATTTGAACACTGGGTTACAGAGGTTAAAGCATTTCGGGAAATGTTGGTCGCCTTGGGACGGGCAAGACAGGCTGAAATAAAAAAATTATATCAAGACATGTCAGTCACTTCAGAAACAGAGTATGAATGGATTTCTTCAAAATGGCTGAAAGATTGGATGAATGAGAAAATTCAAACGCCGCCAGTGGACAATTCCTCACTGCTATGTTCTCATGGGAAACTCAACCCAAATCAAGTTCTTTATGCGAAGAGAGTCAACATCAAAGCTGCAGACGAAATTTTCAGAAATTATGGTGGATTGCCAAGACTTCAAAGTGACTCGATGTGTGTCAACTGTGTGAAAGAACAATGCAGAAGAATACGATTTGAGTCCAGGCTGGCTGAAGATTACAAGTTTGTGTCCGATGCTTTGAAGTCTCAAACATCGAACAGTGAGAAGTACTTTTTGGTCGGTCGACGATCGCTTCTGAGATGGAAAGCTTTGGCAAACTACTATGAAGAGATGCGACAGAGTTTGATGGACAGCTGTCAAGTTACAGCCAATCACGACGTGGAGGACGAAGACGACGCTAACGCTAGTAGAAATGAAAACAATGATGTAAGCATGACAGAAGAGGAGAACGCAACTGAGCAGGCTGACAAGAATGTACAGGAAAATGGCGCTGAGGAGGACGAAAATGATAGCGATTCTAAGTTCAACGAAGACTTGCTTTGTGAACACGGGGACCTTTCTTCGGACGAGTCATGTCGGAGGCTTGTGCCAGATGTCGTGTGGAAGAGGTTAAAATATTACTTTCCTTCCTCGCCCGAGTTTGCAGCTTCTCAAGCAGTGTGTCGATCGTGTCAGGCAGAAGACGAAGAGGAGCGACAAAAGACTGAGACGTATAAATTACTAGCATCGGAACAGAGAGCTGCCGTTAGTCAACTGTATCTCGACAGGAATCGGCCCTCGTTTAATAACAGTGACCCGTTCGTCGCCTGTGCTATTTCGAAAGATTTTCTTGATCAGTGGAGGCAGTTCTTGAGGTACCCAGTAAAGAATGTCCCACCAAAGAGTATCGTCAATGCTCCTCTCCTGTGCCCTCATGAAAAATTCCTCTTCAATCCTGAGTGCGAGGATGACATGGATGGTGCGAGCCAAGAGTTATGTTATGTTTGGCAACACGAGTGGAACACGCTTACCCAGTCCTACCCGTACGATCACGTGATCAGCGTCACCAAAAATGTAACCGAAGACGATGTTCGAGAACTTGTGACAAGTCCCGAAGTGTGCACGGAATGCTGTTTTGCGCGGATACAGGAAAGAGCCCAACACGTGGAGAATTATCGTTACGGTACAATCTTCGTGCGGAAAATAACAAAGGACCACAGCGAGAAGGACATACAGCAAGCCTTGAATGATAGTACCTCGAGTAAAGACGGTGATTCGTATTCGTTCGACCCAGACTTCCAGACACCACCGGACAGTAAGAAACCAAAGCTAAACCGTGATTCTCGAGCCCGTCGAAGTTCAAGGCACCGTAAACAGCGCGGAGAAGTCTCTTTGACTGTTGGATCAACAGAGACTTTAAGAGATGTTAAACTGCAGCTAATGAAAAGCTTTTCGGTGATGCCAATGGATCAACATCTCACGTTAAATGGTGTCACGCTCTCCAATAATGAAGCCACTCTCCTTTCTTTGGGAATCAAGCCAGGATCTTTATTACTACTACAGATTGATGAACCTCAAGGGGCCATCTCACAGGACGCTCTTCCAGTGAGCAACGCCCCCGAAGAAGGTTTCAAAGGAACTGGTTTACTTGGTCACTCGTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q86UV5	Ubiquitin carboxyl-terminal hydrolase 48 OS=Homo sapiens OX=9606 GN=USP48 PE=1 SV=1
Q5ZM45	Ubiquitin carboxyl-terminal hydrolase 48 OS=Gallus gallus OX=9031 GN=USP48 PE=2 SV=1
A0A0R4IB93	Ubiquitin carboxyl-terminal hydrolase 48 OS=Danio rerio OX=7955 GN=usp48 PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003580 (this species only)
Ubiquitin family	ULD\|UFD/UBQ\|UBQ_Other · all ubiquitin genes in this species
Ubiquitin family	ULD\|UFD/UBQ\|UBQ_PIM · all ubiquitin genes in this species
Ubiquitin family	DUB\|USP\|USP · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00443 all species →	UCH	Ubiquitin carboxyl-terminal hydrolase	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR018200 all species →	Conserved_site	Ubiquitin specific protease, conserved site	Interproscan
IPR035927 all species →	Homologous_superfamily	DUSP-like superfamily	Interproscan
IPR001394 all species →	Domain	Peptidase C19, ubiquitin carboxyl-terminal hydrolase	Interproscan
IPR033841 all species →	Domain	Ubiquitin-specific peptidase 48	Interproscan
IPR044743 all species →	Domain	Ubiquitin-specific-processing protease 48, Ubl domain	Interproscan
IPR029071 all species →	Homologous_superfamily	Ubiquitin-like domain superfamily	Interproscan
IPR000626 all species →	Domain	Ubiquitin-like domain	Interproscan
IPR028889 all species →	Domain	Ubiquitin specific protease domain	Interproscan
IPR050164 all species →	Family	Ubiquitin carboxyl-terminal hydrolases	Interproscan
IPR038765 all species →	Homologous_superfamily	Papain-like cysteine peptidase superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24006 all species →	UBIQUITIN CARBOXYL-TERMINAL HYDROLASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004843 all species →	Molecular Function	cysteine-type deubiquitinase activity	Interproscan
GO:0016579 all species →	Biological Process	protein deubiquitination	Interproscan
GO:0004197 all species →	Molecular Function	cysteine-type endopeptidase activity	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11858	USP48; ubiquitin carboxyl-terminal hydrolase 48	EC:3.4.19.12	Ubiquitin system	ko04121	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of evm.model.Ap6.483 across 49 RNA-seq samples of Astrangia poculata. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

49Samples

0TPM > 0

4Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole organism · cold control	14	0	0.00	0.00
whole organism · heat control	12	0	0.00	0.00
whole organism · cold challenge	12	0	0.00	0.00
whole organism · heat challenge	11	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR10674714	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674715	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674724	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674733	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674734	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674735	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674736	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674737	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674739	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674743	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674746	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674747	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674748	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674750	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674706	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674707	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674708	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674717	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674718	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674720	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674721	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674725	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674731	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674741	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674752	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674753	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674711	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674712	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674713	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674722	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674723	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674730	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674732	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674738	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674740	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674744	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674745	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674749	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674709	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674710	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674716	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674719	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674726	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674727	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674728	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674729	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674742	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674751	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674754	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293

Source: CnidoSite RNA-seq expression matrices (APOCU_TPM, StringTie quantification over 49 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.