Gene detail

Detailed information of evm.model.Ap6.922 in Astrangia poculata

Genomic Location: Ap6:8837784...8839958
NR annotation: XP_020608109.1, ski oncogene-like [Orbicella faveolata]
Species Astrangia poculata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

evm.model.Ap6.922

atggatcgcggcaaattctcgcgctcagacaacccgcttatagacgaaatcctacagaaataccgagactgctcgacagactccataacaggacccaaaggcttcaccgcaaagaaatcaaggaattcgacaacagacgacgttgctaaacatagcgcatatgttgcgtctagtgaacatactaggacggcgatgataagaaagaccgtcacagtaaggatgccaccgccgaaggggcaagacggttttaacttcaaggaaaccatcatcgaccgcgtgcctttagcttgcttcagctctggcggcgagaagagagtttgctacacggagctcatcaataaagttctaaacgattttgacggcaaagagattgacgcaaatcgcgatcgtctacaaatctactgtcctcgctgctcgcctcatcagctggagttattcaaactggctggagttttatcctggtcggccacatcggccagttttatttctaagactgactcatttcgtctgatcggggttttaaccgcgagcgaggtgccgcgtcggccgagtcgtattttccccgtggacagcttagaagtgtatcacgagtgttttggcggttgcgtgggcacgctggaaattgacaagtacacggatccgtacgcgaagtgcataacgtgctcgcaatgcgatggagtattctctccaaggaggtttgttgttcataatcattcctcaggggagatacatacttgccactggggtttcgacgacgcaaaatggcgcctttatctgatgctgtgcaacgaacaacccacgttgcacgtacagaaactctgggagatgctcatgaacaaattttcggacggacagcgctggaaacgcgcttcgccttcgaacgaagaagactcgaacgtgaacgagcgcgacggtggtgcgagtccaacgaagaggccgcgcgtggagaaatcgcgcgagtcgcgcgacgggcaaaacgatgatagcgactcgaatgggaacagtagcagtagcgggagcagttctaatggagatatcgtgtgcagaaggtctgcttttagaccgtggtcccccttgcacggtcgcacaaaaagcacagaaaactccagtgcttccagcggggcacattccatgtctatgatgtcgtccggatctcctgcgaggcttttcgcccctcacactattccgtacctggcgagcgactgcccctacacaccgccacatcctcacaacattcaccgtcacgctttcaagggagacatacgaaagcccattccaaaagtcgagccgagactcagtcccgcaacggtttcgcacactgtcagtgaaattctagcgaccccgtccgccaaagatcctagatccctggagaaaactgcaagagaaatgcttgaagttgtagctcaaaacgagagatggggaggctatgagaaatcgaacagtcccaaccgagagagagaaattgaagcaaccgacaacgaaagtgcacttttggaggagcgcatttaccagacgctagcgagcttaaccaagaacgaacgactccccgcttcgcccagagagttaagtggcttattagctaaggaaataaaagatttatttgctcagcatacggaggagaaagtgaaagaactgagtactgtgcgagacaaacttagcgcggaactcgagtcgttgcaaaaggaacacgcgacgaaaatggaggaagcattacaagaactcaaaagcgttcaaaaggaattaagaatgattcaaacaagtcagcgacttgaaatggatagcctgaacgagaaaaatatcaaactacagctcgaggtcaaaaaattcaaagctgagaaggatgacattctctcgatgaactcaaaagagaccatcaatgtactgcaacaagatgtgagagacttgtcgaagaaattagaagagaaggacagctactgtcgagagctagagaatgagattaagggctttcactcgtggattaacaatcaaagattgcataataccagttctcaatttatctacaccgtgaacaatcccagacgagactctgaatcggtcattaggagccggcacatgttaaatggaacttctgcgggtggcttttgccgcaaaacaagtgttaacaaaactaatgggtcgcttcgtaacggcgaaagttccgaggaagaacaatga

Transcript

evm.model.Ap6.922

ATGGATCGCGGCAAATTCTCGCGCTCAGACAACCCGCTTATAGACGAAATCCTACAGAAATACCGAGACTGCTCGACAGACTCCATAACAGGACCCAAAGGCTTCACCGCAAAGAAATCAAGGAATTCGACAACAGACGACGTTGCTAAACATAGCGCATATGTTGCGTCTAGTGAACATACTAGGACGGCGATGATAAGAAAGACCGTCACAGTAAGGATGCCACCGCCGAAGGGGCAAGACGGTTTTAACTTCAAGGAAACCATCATCGACCGCGTGCCTTTAGCTTGCTTCAGCTCTGGCGGCGAGAAGAGAGTTTGCTACACGGAGCTCATCAATAAAGTTCTAAACGATTTTGACGGCAAAGAGATTGACGCAAATCGCGATCGTCTACAAATCTACTGTCCTCGCTGCTCGCCTCATCAGCTGGAGTTATTCAAACTGGCTGGAGTTTTATCCTGGTCGGCCACATCGGCCAGTTTTATTTCTAAGACTGACTCATTTCGTCTGATCGGGGTTTTAACCGCGAGCGAGGTGCCGCGTCGGCCGAGTCGTATTTTCCCCGTGGACAGCTTAGAAGTGTATCACGAGTGTTTTGGCGGTTGCGTGGGCACGCTGGAAATTGACAAGTACACGGATCCGTACGCGAAGTGCATAACGTGCTCGCAATGCGATGGAGTATTCTCTCCAAGGAGGTTTGTTGTTCATAATCATTCCTCAGGGGAGATACATACTTGCCACTGGGGTTTCGACGACGCAAAATGGCGCCTTTATCTGATGCTGTGCAACGAACAACCCACGTTGCACGTACAGAAACTCTGGGAGATGCTCATGAACAAATTTTCGGACGGACAGCGCTGGAAACGCGCTTCGCCTTCGAACGAAGAAGACTCGAACGTGAACGAGCGCGACGGTGGTGCGAGTCCAACGAAGAGGCCGCGCGTGGAGAAATCGCGCGAGTCGCGCGACGGGCAAAACGATGATAGCGACTCGAATGGGAACAGTAGCAGTAGCGGGAGCAGTTCTAATGGAGATATCGTGTGCAGAAGGTCTGCTTTTAGACCGTGGTCCCCCTTGCACGGTCGCACAAAAAGCACAGAAAACTCCAGTGCTTCCAGCGGGGCACATTCCATGTCTATGATGTCGTCCGGATCTCCTGCGAGGCTTTTCGCCCCTCACACTATTCCGTACCTGGCGAGCGACTGCCCCTACACACCGCCACATCCTCACAACATTCACCGTCACGCTTTCAAGGGAGACATACGAAAGCCCATTCCAAAAGTCGAGCCGAGACTCAGTCCCGCAACGGTTTCGCACACTGTCAGTGAAATTCTAGCGACCCCGTCCGCCAAAGATCCTAGATCCCTGGAGAAAACTGCAAGAGAAATGCTTGAAGTTGTAGCTCAAAACGAGAGATGGGGAGGCTATGAGAAATCGAACAGTCCCAACCGAGAGAGAGAAATTGAAGCAACCGACAACGAAAGTGCACTTTTGGAGGAGCGCATTTACCAGACGCTAGCGAGCTTAACCAAGAACGAACGACTCCCCGCTTCGCCCAGAGAGTTAAGTGGCTTATTAGCTAAGGAAATAAAAGATTTATTTGCTCAGCATACGGAGGAGAAAGTGAAAGAACTGAGTACTGTGCGAGACAAACTTAGCGCGGAACTCGAGTCGTTGCAAAAGGAACACGCGACGAAAATGGAGGAAGCATTACAAGAACTCAAAAGCGTTCAAAAGGAATTAAGAATGATTCAAACAAGTCAGCGACTTGAAATGGATAGCCTGAACGAGAAAAATATCAAACTACAGCTCGAGGTCAAAAAATTCAAAGCTGAGAAGGATGACATTCTCTCGATGAACTCAAAAGAGACCATCAATGTACTGCAACAAGATGTGAGAGACTTGTCGAAGAAATTAGAAGAGAAGGACAGCTACTGTCGAGAGCTAGAGAATGAGATTAAGGGCTTTCACTCGTGGATTAACAATCAAAGATTGCATAATACCAGTTCTCAATTTATCTACACCGTGAACAATCCCAGACGAGACTCTGAATCGGTCATTAGGAGCCGGCACATGTTAAATGGAACTTCTGCGGGTGGCTTTTGCCGCAAAACAAGTGTTAACAAAACTAATGGGTCGCTTCGTAACGGCGAAAGTTCCGAGGAAGAACAATGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P17863	Transforming protein Ski OS=Avian erythroblastosis virus (strain Sloan-Kettering) OX=11862 GN=V-SKI PE=1 SV=1
P49140	Ski oncogene OS=Gallus gallus OX=9031 GN=SKI PE=1 SV=1
P12755	Ski oncogene OS=Homo sapiens OX=9606 GN=SKI PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0008501 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF08782 all species →	c-SKI_SMAD_bind	c-SKI Smad4 binding domain	Domain	Interproscan
PF02437 all species →	Ski_Sno	SKI/SNO/DAC family	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR014890 all species →	Domain	c-SKI SMAD4-binding domain	Interproscan
IPR009061 all species →	Homologous_superfamily	Putative DNA-binding domain superfamily	Interproscan
IPR003380 all species →	Domain	SKI/SNO/DAC domain	Interproscan
IPR023216 all species →	Family	Transcription regulator SKI/SnoN	Interproscan
IPR010919 all species →	Homologous_superfamily	SAND-like domain superfamily	Interproscan
IPR037000 all species →	Homologous_superfamily	Ski-like, DNA-binding domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10005 all species →	SKI ONCOGENE-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0046332 all species →	Molecular Function	SMAD binding	Interproscan
GO:0000978 all species →	Molecular Function	RNA polymerase II cis-regulatory region sequence-specific DNA binding	Interproscan
GO:0000981 all species →	Molecular Function	DNA-binding transcription factor activity, RNA polymerase II-specific	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0030514 all species →	Biological Process	negative regulation of BMP signaling pathway	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K26503	SKI; Ski oncogene	-	TGF-beta signaling pathway	ko04350	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of evm.model.Ap6.922 across 49 RNA-seq samples of Astrangia poculata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

49Samples

3TPM > 0

4Conditions

211.4Max TPM

10.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
whole organism · cold control	14	0	0.00	0.00
whole organism · heat control	12	3	43.14	211.35
whole organism · cold challenge	12	0	0.00	0.00
whole organism · heat challenge	11	0	0.00	0.00

Per sample · hover a bar for the full sample record

Show the sample table (49 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR10674714	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674715	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674724	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674733	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674734	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674735	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674736	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674737	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674739	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674743	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674746	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674747	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674748	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674750	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674725	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	211.35
SRR10674706	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	190.46
SRR10674753	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	115.89
SRR10674707	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674708	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674717	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674718	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674720	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674721	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674731	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674741	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674752	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674711	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674712	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674713	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674722	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674723	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674730	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674732	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674738	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674740	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674744	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674745	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674749	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674709	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674710	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674716	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674719	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674726	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674727	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674728	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674729	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674742	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674751	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674754	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00

Source: CnidoSite RNA-seq expression matrices (APOCU_TPM, StringTie quantification over 49 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Astrangia poculata tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	8	evm.model.Ap5.490	0.842358071185491
Negatively correlated	5	evm.model.Ap5.2600	-0.289092493422838

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Astrangia poculata, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →