Gene detail

Detailed information of evm.model.Ap7.2363 in Astrangia poculata

Genomic Location: Ap7:24893993...24922075
NR annotation: XP_020602113.1, unconventional myosin-Ib-like isoform X1 [Orbicella faveolata]
Species Astrangia poculata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

evm.model.Ap7.2363

atggctgaaacaggccaggcaacggcaggcgggcggagcatgttggacaacatggttggagtcagtgacatggttcttcttgagcccttaactgaagattctttgctagagaacctgtgggatagatacaacaataaagatatctatacctacattggtaacgtggtggtatcaatcaacccttatcgtaaattcaacttgtatactcctgagaggatatttgagtacagatctagaaacatctatgaactacccccacacatatttgccatagctgatgttgcttacagatccatgagggattacaaccaggaccaatgtattcttattactggtgaaagtggagctggcaaaacagaggcatcaaaggttgttatgcagtatgtagcagcagtgtctggcaaaggctgggaagtggatagagtcaaggaacagttgctgcagtctaatcctgtcttagaagcttttggcaatgcaaagactcttaggaatgacaactcctctcgctttggcaaatacatggacattgagtttgacttcaagggtgatcctgttggaggagtcataacaaaatatttgctggaaaagtcacgtgttgttcaccaagcacaaggggaaagaaattttcatattttctaccaccttctttctggtgcctctgatgaacttcttggtaaactaaatcttgaaagtgattgtagtacatacaattacctcaatcatagtggatgtacaaaagttgacacaattgatgacaagaaggacttcttaatagttgagagggccatggatattgtaggattttctcaagaagagaaacagtccatctacactcttttgtctgctatcctgaaccttggaaatgtgacatttgatgaagtttttgataaaagcagtggacatgatgctgtagctgtcacaaatgagaaatttttagagagggcttgtgagatgttgcagtgtggaactcatttactcaaggatgctctgacaaggagaacagtggaagctggaaatgagagaatggccactcctcttacagctgcccaagcctactatgcaagagatgctctttccaaagccacttatcgaaggatgttttcctggttgattcaaagagtcaatgatagtataagggtgaaaaagaagggcaagagaaaagtgattggtgtgttggacatttatggatttgagatatttaagaggaacagttttgagcagttcattatcaattactgtaatgagaagctgcaacagatttttattgagctgactctccagtcagagcaagaggagtatgtcagagagggaattgaatggacaacaatagattattttaacaatgctatcatctgtgatttgattgaaaagagtcatgttggtattatagctcttcttgatgaggaatgtttgagacctggagaggtcacagatgagacatttctaactaagatcaacagacactgcatcgagcatccacactatgagagcagagcaagcaagaaattcctctctgacgcttctctgcctcacgactgtttcagactaatacactatgctggaagtgtaacatattgtgtaaatggttttgtagacaagaacaacgatctgttgtacagagacctttctcagtgtctgtatgcatgtggtcacccacttgcaaagacgctcttcccagaaggttgccccaccaaggcatcaaagaagagacctccaacgacaggaacgcagttcaaggtttcagtctcggagctaatgaagaatcttaaatccaagaaccctaattacatcagatgtatcaagccaaacgacaaaaaagtagcggggctgtttgacgacaaacttgttcgacatcaggttcgataccttggattgatggagaacgttcgtgtcaaaagagcaggctttgcgttcagacaggagtatgatgtggcacttcagaggtacaagatgctttgtagtaaaacctggcctaactgggttgggatgccaaaagaagggctaaaagaactgctcaagagtctgaatatcaaaccgacagcgtatgcgtatggcagaacaaagatcttcataagaaaccctcgaacgttgtttgaccttgaagagagacgtaaacaaggaatgcaccgcttagctatcatcattcaaaagattttcaggggatggaggcagcgaacacagtatcgaaagatgagagaaagtgaaattatcatcgccaagtattatcgtggattcagggatcgacgtctttatctgaagaagagggacgcggccattgttatagcctgttttgttcgtggctggaaggcgcggaagctttacaaagccatgttatacgagaagaagtgcatttgggccgttggtgtaattcgcacctacttttatggatggcaggcccgaaaactttacagatccatggtccttgaaaagaagcgcattgaggccgccactataattgcggcttattgtaaaggctggaaggttcgtcgtgagtacaacccgaaatttagacgaaatgctgctccgaagatcatcaaattccttcgactcttcttgtgctacagatatctgaccgcgctaaagaagaatcttccgtcagtctcacccacggatacacattggccctcgtcttcacccttgtttaggaaaactaatggtctcctcaaggatatttaccacgcttggagatgcaagaggttcagagaccgctgtactccagaaagacgagcgattctgaaagaaaaactgcaagccagcgaggtgttcaaagacaagaaatcctcttatccttccaccgtaccagttccgtttcaaagcgaccgtgcgaatctcatggcaaatccaaagtggaaaaagaacgccaagaacaacaacctgcgtatatatgcggattctgcggtgcctcacatcctgactatttcagactcggaactgctggtgttggaccccaagtcgtttctaacaaaatacaacgtggacttgggtgatattcagagaatctccgtgagtccgctgaaagatggagtgattgtgttccacatacgtacggacaaacaagacaaaaatcacctcaaaggcgacttcatgtttcacacggagcacgtggtcgaattagtagccaagctgttagtacaggtagaatctcaacaggacatgtctgcgcctgtgcacgtgtctgacaggttcgctgtgaattttgctggatcacacgtggaactcaacttcaagccagcagacaaagatctttctcagccattactttgtagaagaaaaggggctgtgatagacgttttggtctga

Transcript

evm.model.Ap7.2363

ATGGCTGAAACAGGCCAGGCAACGGCAGGCGGGCGGAGCATGTTGGACAACATGGTTGGAGTCAGTGACATGGTTCTTCTTGAGCCCTTAACTGAAGATTCTTTGCTAGAGAACCTGTGGGATAGATACAACAATAAAGATATCTATACCTACATTGGTAACGTGGTGGTATCAATCAACCCTTATCGTAAATTCAACTTGTATACTCCTGAGAGGATATTTGAGTACAGATCTAGAAACATCTATGAACTACCCCCACACATATTTGCCATAGCTGATGTTGCTTACAGATCCATGAGGGATTACAACCAGGACCAATGTATTCTTATTACTGGTGAAAGTGGAGCTGGCAAAACAGAGGCATCAAAGGTTGTTATGCAGTATGTAGCAGCAGTGTCTGGCAAAGGCTGGGAAGTGGATAGAGTCAAGGAACAGTTGCTGCAGTCTAATCCTGTCTTAGAAGCTTTTGGCAATGCAAAGACTCTTAGGAATGACAACTCCTCTCGCTTTGGCAAATACATGGACATTGAGTTTGACTTCAAGGGTGATCCTGTTGGAGGAGTCATAACAAAATATTTGCTGGAAAAGTCACGTGTTGTTCACCAAGCACAAGGGGAAAGAAATTTTCATATTTTCTACCACCTTCTTTCTGGTGCCTCTGATGAACTTCTTGGTAAACTAAATCTTGAAAGTGATTGTAGTACATACAATTACCTCAATCATAGTGGATGTACAAAAGTTGACACAATTGATGACAAGAAGGACTTCTTAATAGTTGAGAGGGCCATGGATATTGTAGGATTTTCTCAAGAAGAGAAACAGTCCATCTACACTCTTTTGTCTGCTATCCTGAACCTTGGAAATGTGACATTTGATGAAGTTTTTGATAAAAGCAGTGGACATGATGCTGTAGCTGTCACAAATGAGAAATTTTTAGAGAGGGCTTGTGAGATGTTGCAGTGTGGAACTCATTTACTCAAGGATGCTCTGACAAGGAGAACAGTGGAAGCTGGAAATGAGAGAATGGCCACTCCTCTTACAGCTGCCCAAGCCTACTATGCAAGAGATGCTCTTTCCAAAGCCACTTATCGAAGGATGTTTTCCTGGTTGATTCAAAGAGTCAATGATAGTATAAGGGTGAAAAAGAAGGGCAAGAGAAAAGTGATTGGTGTGTTGGACATTTATGGATTTGAGATATTTAAGAGGAACAGTTTTGAGCAGTTCATTATCAATTACTGTAATGAGAAGCTGCAACAGATTTTTATTGAGCTGACTCTCCAGTCAGAGCAAGAGGAGTATGTCAGAGAGGGAATTGAATGGACAACAATAGATTATTTTAACAATGCTATCATCTGTGATTTGATTGAAAAGAGTCATGTTGGTATTATAGCTCTTCTTGATGAGGAATGTTTGAGACCTGGAGAGGTCACAGATGAGACATTTCTAACTAAGATCAACAGACACTGCATCGAGCATCCACACTATGAGAGCAGAGCAAGCAAGAAATTCCTCTCTGACGCTTCTCTGCCTCACGACTGTTTCAGACTAATACACTATGCTGGAAGTGTAACATATTGTGTAAATGGTTTTGTAGACAAGAACAACGATCTGTTGTACAGAGACCTTTCTCAGTGTCTGTATGCATGTGGTCACCCACTTGCAAAGACGCTCTTCCCAGAAGGTTGCCCCACCAAGGCATCAAAGAAGAGACCTCCAACGACAGGAACGCAGTTCAAGGTTTCAGTCTCGGAGCTAATGAAGAATCTTAAATCCAAGAACCCTAATTACATCAGATGTATCAAGCCAAACGACAAAAAAGTAGCGGGGCTGTTTGACGACAAACTTGTTCGACATCAGGTTCGATACCTTGGATTGATGGAGAACGTTCGTGTCAAAAGAGCAGGCTTTGCGTTCAGACAGGAGTATGATGTGGCACTTCAGAGGTACAAGATGCTTTGTAGTAAAACCTGGCCTAACTGGGTTGGGATGCCAAAAGAAGGGCTAAAAGAACTGCTCAAGAGTCTGAATATCAAACCGACAGCGTATGCGTATGGCAGAACAAAGATCTTCATAAGAAACCCTCGAACGTTGTTTGACCTTGAAGAGAGACGTAAACAAGGAATGCACCGCTTAGCTATCATCATTCAAAAGATTTTCAGGGGATGGAGGCAGCGAACACAGTATCGAAAGATGAGAGAAAGTGAAATTATCATCGCCAAGTATTATCGTGGATTCAGGGATCGACGTCTTTATCTGAAGAAGAGGGACGCGGCCATTGTTATAGCCTGTTTTGTTCGTGGCTGGAAGGCGCGGAAGCTTTACAAAGCCATGTTATACGAGAAGAAGTGCATTTGGGCCGTTGGTGTAATTCGCACCTACTTTTATGGATGGCAGGCCCGAAAACTTTACAGATCCATGGTCCTTGAAAAGAAGCGCATTGAGGCCGCCACTATAATTGCGGCTTATTGTAAAGGCTGGAAGGTTCGTCGTGAGTACAACCCGAAATTTAGACGAAATGCTGCTCCGAAGATCATCAAATTCCTTCGACTCTTCTTGTGCTACAGATATCTGACCGCGCTAAAGAAGAATCTTCCGTCAGTCTCACCCACGGATACACATTGGCCCTCGTCTTCACCCTTGTTTAGGAAAACTAATGGTCTCCTCAAGGATATTTACCACGCTTGGAGATGCAAGAGGTTCAGAGACCGCTGTACTCCAGAAAGACGAGCGATTCTGAAAGAAAAACTGCAAGCCAGCGAGGTGTTCAAAGACAAGAAATCCTCTTATCCTTCCACCGTACCAGTTCCGTTTCAAAGCGACCGTGCGAATCTCATGGCAAATCCAAAGTGGAAAAAGAACGCCAAGAACAACAACCTGCGTATATATGCGGATTCTGCGGTGCCTCACATCCTGACTATTTCAGACTCGGAACTGCTGGTGTTGGACCCCAAGTCGTTTCTAACAAAATACAACGTGGACTTGGGTGATATTCAGAGAATCTCCGTGAGTCCGCTGAAAGATGGAGTGATTGTGTTCCACATACGTACGGACAAACAAGACAAAAATCACCTCAAAGGCGACTTCATGTTTCACACGGAGCACGTGGTCGAATTAGTAGCCAAGCTGTTAGTACAGGTAGAATCTCAACAGGACATGTCTGCGCCTGTGCACGTGTCTGACAGGTTCGCTGTGAATTTTGCTGGATCACACGTGGAACTCAACTTCAAGCCAGCAGACAAAGATCTTTCTCAGCCATTACTTTGTAGAAGAAAAGGGGCTGTGATAGACGTTTTGGTCTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P46735	Unconventional myosin-Ib OS=Mus musculus OX=10090 GN=Myo1b PE=1 SV=3
O43795	Unconventional myosin-Ib OS=Homo sapiens OX=9606 GN=MYO1B PE=1 SV=3
Q05096	Unconventional myosin-Ib OS=Rattus norvegicus OX=10116 GN=Myo1b PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000485 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00612 all species →	IQ	IQ calmodulin-binding motif	Motif	Interproscan
PF06017 all species →	Myosin_TH1	Unconventional myosin tail, actin- and lipid-binding	Domain	Interproscan
PF00063 all species →	Myosin_head	Myosin head (motor domain)	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036961 all species →	Homologous_superfamily	Kinesin motor domain superfamily	Interproscan
IPR036072 all species →	Domain	Class I myosin, motor domain	Interproscan
IPR010926 all species →	Domain	Class I myosin tail homology domain	Interproscan
IPR001609 all species →	Domain	Myosin head, motor domain	Interproscan
IPR000048 all species →	Binding_site	IQ motif, EF-hand binding site	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13140 all species →	MYOSIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003774 all species →	Molecular Function	cytoskeletal motor activity	Interproscan
GO:0016459 all species →	Cellular Component	myosin complex	Interproscan
GO:0000146 all species →	Molecular Function	microfilament motor activity	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0005902 all species →	Cellular Component	microvillus	Interproscan
GO:0007015 all species →	Biological Process	actin filament organization	Interproscan
GO:0015629 all species →	Cellular Component	actin cytoskeleton	Interproscan
GO:0030050 all species →	Biological Process	vesicle transport along actin filament	Interproscan
GO:0031982 all species →	Cellular Component	vesicle	Interproscan
GO:0051015 all species →	Molecular Function	actin filament binding	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10356	MYO1; myosin I	-	Exosome	ko04147	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of evm.model.Ap7.2363 across 49 RNA-seq samples of Astrangia poculata. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

49Samples

0TPM > 0

4Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole organism · cold control	14	0	0.00	0.00
whole organism · heat control	12	0	0.00	0.00
whole organism · cold challenge	12	0	0.00	0.00
whole organism · heat challenge	11	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR10674714	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674715	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674724	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674733	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674734	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674735	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674736	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674737	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674739	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674743	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674746	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674747	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674748	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674750	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674706	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674707	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674708	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674717	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674718	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674720	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674721	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674725	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674731	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674741	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674752	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674753	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674711	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674712	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674713	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674722	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674723	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674730	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674732	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674738	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674740	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674744	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674745	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674749	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674709	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674710	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674716	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674719	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674726	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674727	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674728	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674729	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674742	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674751	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674754	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293

Source: CnidoSite RNA-seq expression matrices (APOCU_TPM, StringTie quantification over 49 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.