Gene detail

Detailed information of evm.model.Ap7.366 in Astrangia poculata

Genomic Location: Ap7:4383347...4392069
NR annotation: KAJ7372174.1, carbohydrate binding [Desmophyllum pertusum]
Species Astrangia poculata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

evm.model.Ap7.366

atggttactttgttcttctttgtgaccattttctgtgtgagtacagcctttgagtgcaagtttgaagaagcagtgaaggctgaagataaactacaagtccatcttgttccgcatacgcacgacgatgtcggctggttgaaaactgtggacgagtacttttatggagctaataattccattcagcatgctggagtgcagtacattttagactctgttattccccagttaagtgcagactcgacaaagcgatttatttacgtggaaatcgcgttcttcgagcgctggtggaacgaacaaaacgaagccatgcgaacggaagtgaagaaactcgtcaaagataaacaactagagtttataaacgctggctggtgtatgaacgatgaggctgggacacattacaatgcgatcattgatcaaatgacttatggattgaactttgtggaggagacattcggatacgatgcaagacctcgcatagcctggcatattgatccctttggtcactcgaacgaacaagcttcaatctttgcacagatgtcttttgatggatttttcttcggccgtattgactaccaggacaaaaagcttcgccttgagcagcagagaatggagctggtctggaggggaagtaaaagtcttggacaaaattcggacattttcaccggtgtactgtacaatggctacaatccacccaaaggattctgctacgatcagttttgtgtagacaacccaattcaggacgacccaaggctgtttgacttcaatgtcaaggaaaccgtggataaatttgtggaagtgacgtgcaaacaagcatcccagtacaaaacaaaccacatcatgttaacaatgggagcagatttcatgtatgagaatgctaacctgtggtataaaaatttggacaaactaattaaatacgtaaatgctgatggccgtgtgaatgcattctactctacaccaacaacctacttagatgctctgtacaaagctaaccagacatgggaactaaagactgatgacttctttccttatgcagactgccctcactgttactggactggttatttcactagcaggccagcactcaagcgatatgtcagatacaacaatgatttgcttcaggtctgtaagcaactggagttgataaatggtcctgctaagaagaatggtccgacttctgatactctacgcagagcaatgggtgtggcacaacaccatgacgctgtcagtggtacatcaaaacagcatgtggcagatgactatgctaagcgacttgctattggtgctgtggaatgccaggagttggttggtgatgtgcttggtaaattcacagtgaaaaaccctgcaaccaagcctcctgcattgacattttgcgaccacctcaacatcagtgtctgtccggtaactgaacagagcaaatccttcactgtgactgtctataatcccattgctcgagacgtatccagtgttgttcgcctgccagttgccatggcttcagtggcggtgtttggtccacaaggcaccccgatcgaacaccaagtgctgcctatttctaatgctaccagacagctgcgacaaaatcagaaccagaaacagagtcattcatcatacgagcttgtcttcaccgccaaagtccctgccttagggtttgccacttacttcgtcaactcgaccaagtcggcgtccagactggagaagaagtttttccgacccgtccctaagcacgcttacaaagactccgatgaactgtccatcgaaaatgaattcatcaaactttccttctcgcaggacggaggtcaattgacaagcatgaccgatttgacttctaaaaccaccactgtattgaatcaagcattctactggtataacggcagcaggggaggtagcagcaaacagccctcgggcgcgtacatcttcagacccaacaatagcaatgtgcatctgatctccatgggcagcaaggcagagatcttcaagggtcccgtggtacaggaggtacgtcaggtgatctctccctacatcagtcaggtgatcaggctcaatgctggccagcggcatgcagagtttgagtacactgtggggccgatacccgtaggggatcactggggcaaggaaatcatcacccggtttgacacggatatcaagtcgaaccagctcttctacaccgatgctaatggcagggagatgcaagagcgtaagaggaattaccgaccgacttggaaattgaacatcaccgagccggttgctgggaattattacccggtgaacagtcgaatgtacatcaaggatagcgataagcagctgacaattttgactgagaggtccctgggtgggtccagcatgaaagacggctctatggacatcatgcttcaccgtcgacttctcgtagatgacaagagaggggtgggtgagccgcttaacgagacggggatccttggtaaaggtttaatcgtccgtggaaagttgtgtctgactcttgcgccgccgaagagttctgctgctcttcatcgcgaacttggcgagaagctccttctggaaccagtgctgacctttgcagctaacagtctcactttcaagcagtgggcgagccagtttaactcgatgcacagcggtctaacgcgtgagctccccgccaatgttcacttgctgacactggagacaatgcaggatagcgcattgatccgcgtggagcatcagtacgaggctggtgaagatcccaagctctcgcaagctgtcaacatttcacttgcaggacttttcaccgactttgacatcgagtccatgactgaaatgaacctggctgccaatcagctactgaaggataaacgcccactccactggaacatcaaatcaaggaacaacgtcgaagaaaataagacaaagaagaagagagtcactcgagcggaaactgatttgaacgtggacctcaccccgatgcagatccgcaccttcaaagctgttatcaaacgtcacggaattcctcaatataataagtactag

Transcript

evm.model.Ap7.366

ATGGTTACTTTGTTCTTCTTTGTGACCATTTTCTGTGTGAGTACAGCCTTTGAGTGCAAGTTTGAAGAAGCAGTGAAGGCTGAAGATAAACTACAAGTCCATCTTGTTCCGCATACGCACGACGATGTCGGCTGGTTGAAAACTGTGGACGAGTACTTTTATGGAGCTAATAATTCCATTCAGCATGCTGGAGTGCAGTACATTTTAGACTCTGTTATTCCCCAGTTAAGTGCAGACTCGACAAAGCGATTTATTTACGTGGAAATCGCGTTCTTCGAGCGCTGGTGGAACGAACAAAACGAAGCCATGCGAACGGAAGTGAAGAAACTCGTCAAAGATAAACAACTAGAGTTTATAAACGCTGGCTGGTGTATGAACGATGAGGCTGGGACACATTACAATGCGATCATTGATCAAATGACTTATGGATTGAACTTTGTGGAGGAGACATTCGGATACGATGCAAGACCTCGCATAGCCTGGCATATTGATCCCTTTGGTCACTCGAACGAACAAGCTTCAATCTTTGCACAGATGTCTTTTGATGGATTTTTCTTCGGCCGTATTGACTACCAGGACAAAAAGCTTCGCCTTGAGCAGCAGAGAATGGAGCTGGTCTGGAGGGGAAGTAAAAGTCTTGGACAAAATTCGGACATTTTCACCGGTGTACTGTACAATGGCTACAATCCACCCAAAGGATTCTGCTACGATCAGTTTTGTGTAGACAACCCAATTCAGGACGACCCAAGGCTGTTTGACTTCAATGTCAAGGAAACCGTGGATAAATTTGTGGAAGTGACGTGCAAACAAGCATCCCAGTACAAAACAAACCACATCATGTTAACAATGGGAGCAGATTTCATGTATGAGAATGCTAACCTGTGGTATAAAAATTTGGACAAACTAATTAAATACGTAAATGCTGATGGCCGTGTGAATGCATTCTACTCTACACCAACAACCTACTTAGATGCTCTGTACAAAGCTAACCAGACATGGGAACTAAAGACTGATGACTTCTTTCCTTATGCAGACTGCCCTCACTGTTACTGGACTGGTTATTTCACTAGCAGGCCAGCACTCAAGCGATATGTCAGATACAACAATGATTTGCTTCAGGTCTGTAAGCAACTGGAGTTGATAAATGGTCCTGCTAAGAAGAATGGTCCGACTTCTGATACTCTACGCAGAGCAATGGGTGTGGCACAACACCATGACGCTGTCAGTGGTACATCAAAACAGCATGTGGCAGATGACTATGCTAAGCGACTTGCTATTGGTGCTGTGGAATGCCAGGAGTTGGTTGGTGATGTGCTTGGTAAATTCACAGTGAAAAACCCTGCAACCAAGCCTCCTGCATTGACATTTTGCGACCACCTCAACATCAGTGTCTGTCCGGTAACTGAACAGAGCAAATCCTTCACTGTGACTGTCTATAATCCCATTGCTCGAGACGTATCCAGTGTTGTTCGCCTGCCAGTTGCCATGGCTTCAGTGGCGGTGTTTGGTCCACAAGGCACCCCGATCGAACACCAAGTGCTGCCTATTTCTAATGCTACCAGACAGCTGCGACAAAATCAGAACCAGAAACAGAGTCATTCATCATACGAGCTTGTCTTCACCGCCAAAGTCCCTGCCTTAGGGTTTGCCACTTACTTCGTCAACTCGACCAAGTCGGCGTCCAGACTGGAGAAGAAGTTTTTCCGACCCGTCCCTAAGCACGCTTACAAAGACTCCGATGAACTGTCCATCGAAAATGAATTCATCAAACTTTCCTTCTCGCAGGACGGAGGTCAATTGACAAGCATGACCGATTTGACTTCTAAAACCACCACTGTATTGAATCAAGCATTCTACTGGTATAACGGCAGCAGGGGAGGTAGCAGCAAACAGCCCTCGGGCGCGTACATCTTCAGACCCAACAATAGCAATGTGCATCTGATCTCCATGGGCAGCAAGGCAGAGATCTTCAAGGGTCCCGTGGTACAGGAGGTACGTCAGGTGATCTCTCCCTACATCAGTCAGGTGATCAGGCTCAATGCTGGCCAGCGGCATGCAGAGTTTGAGTACACTGTGGGGCCGATACCCGTAGGGGATCACTGGGGCAAGGAAATCATCACCCGGTTTGACACGGATATCAAGTCGAACCAGCTCTTCTACACCGATGCTAATGGCAGGGAGATGCAAGAGCGTAAGAGGAATTACCGACCGACTTGGAAATTGAACATCACCGAGCCGGTTGCTGGGAATTATTACCCGGTGAACAGTCGAATGTACATCAAGGATAGCGATAAGCAGCTGACAATTTTGACTGAGAGGTCCCTGGGTGGGTCCAGCATGAAAGACGGCTCTATGGACATCATGCTTCACCGTCGACTTCTCGTAGATGACAAGAGAGGGGTGGGTGAGCCGCTTAACGAGACGGGGATCCTTGGTAAAGGTTTAATCGTCCGTGGAAAGTTGTGTCTGACTCTTGCGCCGCCGAAGAGTTCTGCTGCTCTTCATCGCGAACTTGGCGAGAAGCTCCTTCTGGAACCAGTGCTGACCTTTGCAGCTAACAGTCTCACTTTCAAGCAGTGGGCGAGCCAGTTTAACTCGATGCACAGCGGTCTAACGCGTGAGCTCCCCGCCAATGTTCACTTGCTGACACTGGAGACAATGCAGGATAGCGCATTGATCCGCGTGGAGCATCAGTACGAGGCTGGTGAAGATCCCAAGCTCTCGCAAGCTGTCAACATTTCACTTGCAGGACTTTTCACCGACTTTGACATCGAGTCCATGACTGAAATGAACCTGGCTGCCAATCAGCTACTGAAGGATAAACGCCCACTCCACTGGAACATCAAATCAAGGAACAACGTCGAAGAAAATAAGACAAAGAAGAAGAGAGTCACTCGAGCGGAAACTGATTTGAACGTGGACCTCACCCCGATGCAGATCCGCACCTTCAAAGCTGTTATCAAACGTCACGGAATTCCTCAATATAATAAGTACTAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q60HE9	Lysosomal alpha-mannosidase OS=Macaca fascicularis OX=9541 GN=MAN2B1 PE=2 SV=1
O00754	Lysosomal alpha-mannosidase OS=Homo sapiens OX=9606 GN=MAN2B1 PE=1 SV=3
O46432	Lysosomal alpha-mannosidase OS=Felis catus OX=9685 GN=MAN2B1 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002052 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF21260 all species →	Laman-like_dom	Lysosomal alpha-mannosidase-like, central domain	Domain	Interproscan
PF07748 all species →	Glyco_hydro_38C	Glycosyl hydrolases family 38 C-terminal domain	Domain	Interproscan
PF09261 all species →	Alpha-mann_mid	Alpha mannosidase middle domain	Domain	Interproscan
PF01074 all species →	Glyco_hydro_38N	Glycosyl hydrolases family 38 N-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR048534 all species →	Domain	Lysosomal alpha-mannosidase-like, central domain	Interproscan
IPR013780 all species →	Homologous_superfamily	Glycosyl hydrolase, all-beta	Interproscan
IPR011330 all species →	Homologous_superfamily	Glycoside hydrolase/deacetylase, beta/alpha-barrel	Interproscan
IPR037094 all species →	Homologous_superfamily	Glycoside hydrolase family 38, central domain superfamily	Interproscan
IPR011682 all species →	Domain	Glycosyl hydrolase family 38, C-terminal	Interproscan
IPR011013 all species →	Homologous_superfamily	Galactose mutarotase-like domain superfamily	Interproscan
IPR050843 all species →	Family	Glycosyl Hydrolase Family 38	Interproscan
IPR015341 all species →	Domain	Glycoside hydrolase family 38, central domain	Interproscan
IPR028995 all species →	Homologous_superfamily	Glycoside hydrolase families 57/38, central domain superfamily	Interproscan
IPR027291 all species →	Homologous_superfamily	Glycoside hydrolase 38, N-terminal domain superfamily	Interproscan
IPR000602 all species →	Domain	Glycoside hydrolase family 38, N-terminal domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11607 all species →	ALPHA-MANNOSIDASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005975 all species →	Biological Process	carbohydrate metabolic process	Interproscan
GO:0004559 all species →	Molecular Function	alpha-mannosidase activity	Interproscan
GO:0006013 all species →	Biological Process	mannose metabolic process	Interproscan
GO:0003824 all species →	Molecular Function	catalytic activity	Interproscan
GO:0030246 all species →	Molecular Function	carbohydrate binding	Interproscan
GO:0005764 all species →	Cellular Component	lysosome	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K12311	MAN2B1, LAMAN; lysosomal alpha-mannosidase	EC:3.2.1.24	Lysosome	ko04142	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of evm.model.Ap7.366 across 49 RNA-seq samples of Astrangia poculata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

49Samples

5TPM > 0

4Conditions

2,999.2Max TPM

200.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
whole organism · cold control	14	1	214.23	2,999.17
whole organism · heat control	12	4	567.72	2,626.72
whole organism · cold challenge	12	0	0.00	0.00
whole organism · heat challenge	11	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR10674724	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	2,999.17
SRR10674714	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674715	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674733	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674734	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674735	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674736	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674737	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674739	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674743	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674746	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674747	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674748	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674750	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674721	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	2,626.72
SRR10674707	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	1,750.99
SRR10674706	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	1,716.84
SRR10674741	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	718.13
SRR10674708	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674717	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674718	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674720	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674725	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674731	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674752	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674753	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674711	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674712	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674713	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674722	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674723	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674730	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674732	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674738	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674740	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674744	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674745	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674749	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674709	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674710	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674716	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674719	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674726	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674727	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674728	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674729	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674742	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674751	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674754	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00

Source: CnidoSite RNA-seq expression matrices (APOCU_TPM, StringTie quantification over 49 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.