Gene detail

Detailed information of evm.model.Ap8.890 in Astrangia poculata

Genomic Location: Ap8:9638429...9641230
NR annotation: XP_020602020.1, uncharacterized protein LOC110041087 [Orbicella faveolata]
Species Astrangia poculata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

evm.model.Ap8.890

atggcgcaaaatctcctcctctggtttatgcttaacgcattactcacagttacaagttctaggacgttatgtcccaggattttctttcaaaacatcaacgaagacaccatgccgtacaaaatcatcgaaggcgtctacaccaagcagaaggacgattacaacaattttccggtgtaccgccgagagaacgacaacttgctattctatcacaccgtcagcaaaggcagcaactatttggtttttggactcaatctaaacgactactttggcgtggctgcgattctctctagagatccctcattttggctgagttctggggtcatagacaggaatgatgtatttggtggaatcgttaacaagtggcagtactacaacagacgcgaacagacaaactactatgtgtcaaccactttttcttcacctatgataaaagccgtatgcgttgatgaagattttcgagaatgtaactcggacagagtctacttgaacgagagtttcgacgatggaaagggcaacactttgaacaatcgcacaaccgactatttttatcgcactgaaggtttgtttcgcaatcttcgtccggtctataaacacaacacccagacatggtatcttcagtacgtggacgactactgggtagtgactggcaagtatagaccgagtaataatgaagataacgtttacatgagagttaaggattttgcactgagacctgaatatatcagcaaaacttggtcggtgtattaccaaggatggcgtgaccaacccaatctcaaggtcatgtgtaggggcgtggcttcaatgtcgaacacttgcccatcaaatccgtgtgacagcaaagccacttgcgtttatacttccggtaacgaaacgctctgtctctgcccttctggctacactggattgaaatgttctgtaaataaacagtgccccacaccaaaccccaaagccagtacagaactcaattttgcttaccctggaaagcgtcccggcgttcttggcatggcgttttgcagtggatcgtatccctctatgagatattatgtgtgtgtggatggcagctacagttcgtactggagcggacaagggtcggcctgcacgagagaagacccgactacggttccttggtatcctcaaactcgaagtacaccttggtatcctcgaactcgagctacagcctggtatcctggaaatcaaggcacgccccaggctaaatccgtcaactttgatgacaaccctattgtagtcccagtggtaatcactgtggctgtcctcgtgcaaatccttttgcctttcgtcctgtggtgctgcgctttgtgcaggacatcctgcaaggaagtcgaggaacaagaagatgaccagaggagaatggaccaagttggcgaagaacttgggaggcgtcttcaaacagttgctgttgcaggaagtcaagaggaactcgaccaaggcgtgcaagagtacaggcaagctgttcaagattaccaaagggaaagtgaggcgaaagaactgagccgcaaacgaggtttcgtcagaaatgcaagtttatgtaggcttatatccatggatttgtatttctccttctacctgtggcttatttacttcgttggttgtggagtgtctcactgcaccgtgtacggttcagtctttgaggtgttgagaatcttcgctattgtaatgctttttgtctgccctgtgatcgtctttatagagagctgcttctctcacgagttggactacctcaaaaatataatggaagacgaaacggcttgggggtacatacaaaggatgcaagaggtcccaccgaggatcaacatggttgtagaatgctaccattatgaaacacgcacacgcgttgtttactacacagacgctaacggaaaccagcagtcccgcactgagacttataccgagaaagtagtgacatttgtggaccaggacgagttctcttttggttcatgggttgatgtttccaagagagagatgccagccctgagtaccgtcgctctaactcgggtgaagatcgatccaagtatcctattcggtgatcaagaaacagcggatgactacgagagacaagtggcagaaatgttggagagaaatcgccaccgagatgtcttcactgattactcgtccagtaaagaaattcccgggctgaagaagcggatctctgcgtatgtggacttgagtgtgaagccgttttggattcggcctctgttcttctggatcgccaccttgttgcagatgacttggccttaccgctggctgttcagagccaagacagctaagagctactacgccttgaagaaaaagatgtacaagagtacaacaccgcctatggaggtggacgtgatgaatccgattgcagtcctggctggaaatgcatcgtcagtccccattggtccagacaacacctgcccaggttacccaatgtctgtgataaacaatccaggaacaggcaacctggctttccaaagtggcagcacaccatatccacccgttaatccatatctcggacaaagcgatccggcccatggcattagcaccccatacccgccatacaatccagagggcgaatcctcacttcttccttatccagcgccagcacagccaaatggtcctccgcccttgtaccctgcagggataaacaatccagctacagacagcagtacaccgtatccaccgcttaatccatataccggacctgcctctcctccttatcccgccggaccccagccaagtgcacctccaccttcatacgaggacgctgtaggcaacccaccgcagccaaacaatgtaacatga

Transcript

evm.model.Ap8.890

ATGGCGCAAAATCTCCTCCTCTGGTTTATGCTTAACGCATTACTCACAGTTACAAGTTCTAGGACGTTATGTCCCAGGATTTTCTTTCAAAACATCAACGAAGACACCATGCCGTACAAAATCATCGAAGGCGTCTACACCAAGCAGAAGGACGATTACAACAATTTTCCGGTGTACCGCCGAGAGAACGACAACTTGCTATTCTATCACACCGTCAGCAAAGGCAGCAACTATTTGGTTTTTGGACTCAATCTAAACGACTACTTTGGCGTGGCTGCGATTCTCTCTAGAGATCCCTCATTTTGGCTGAGTTCTGGGGTCATAGACAGGAATGATGTATTTGGTGGAATCGTTAACAAGTGGCAGTACTACAACAGACGCGAACAGACAAACTACTATGTGTCAACCACTTTTTCTTCACCTATGATAAAAGCCGTATGCGTTGATGAAGATTTTCGAGAATGTAACTCGGACAGAGTCTACTTGAACGAGAGTTTCGACGATGGAAAGGGCAACACTTTGAACAATCGCACAACCGACTATTTTTATCGCACTGAAGGTTTGTTTCGCAATCTTCGTCCGGTCTATAAACACAACACCCAGACATGGTATCTTCAGTACGTGGACGACTACTGGGTAGTGACTGGCAAGTATAGACCGAGTAATAATGAAGATAACGTTTACATGAGAGTTAAGGATTTTGCACTGAGACCTGAATATATCAGCAAAACTTGGTCGGTGTATTACCAAGGATGGCGTGACCAACCCAATCTCAAGGTCATGTGTAGGGGCGTGGCTTCAATGTCGAACACTTGCCCATCAAATCCGTGTGACAGCAAAGCCACTTGCGTTTATACTTCCGGTAACGAAACGCTCTGTCTCTGCCCTTCTGGCTACACTGGATTGAAATGTTCTGTAAATAAACAGTGCCCCACACCAAACCCCAAAGCCAGTACAGAACTCAATTTTGCTTACCCTGGAAAGCGTCCCGGCGTTCTTGGCATGGCGTTTTGCAGTGGATCGTATCCCTCTATGAGATATTATGTGTGTGTGGATGGCAGCTACAGTTCGTACTGGAGCGGACAAGGGTCGGCCTGCACGAGAGAAGACCCGACTACGGTTCCTTGGTATCCTCAAACTCGAAGTACACCTTGGTATCCTCGAACTCGAGCTACAGCCTGGTATCCTGGAAATCAAGGCACGCCCCAGGCTAAATCCGTCAACTTTGATGACAACCCTATTGTAGTCCCAGTGGTAATCACTGTGGCTGTCCTCGTGCAAATCCTTTTGCCTTTCGTCCTGTGGTGCTGCGCTTTGTGCAGGACATCCTGCAAGGAAGTCGAGGAACAAGAAGATGACCAGAGGAGAATGGACCAAGTTGGCGAAGAACTTGGGAGGCGTCTTCAAACAGTTGCTGTTGCAGGAAGTCAAGAGGAACTCGACCAAGGCGTGCAAGAGTACAGGCAAGCTGTTCAAGATTACCAAAGGGAAAGTGAGGCGAAAGAACTGAGCCGCAAACGAGGTTTCGTCAGAAATGCAAGTTTATGTAGGCTTATATCCATGGATTTGTATTTCTCCTTCTACCTGTGGCTTATTTACTTCGTTGGTTGTGGAGTGTCTCACTGCACCGTGTACGGTTCAGTCTTTGAGGTGTTGAGAATCTTCGCTATTGTAATGCTTTTTGTCTGCCCTGTGATCGTCTTTATAGAGAGCTGCTTCTCTCACGAGTTGGACTACCTCAAAAATATAATGGAAGACGAAACGGCTTGGGGGTACATACAAAGGATGCAAGAGGTCCCACCGAGGATCAACATGGTTGTAGAATGCTACCATTATGAAACACGCACACGCGTTGTTTACTACACAGACGCTAACGGAAACCAGCAGTCCCGCACTGAGACTTATACCGAGAAAGTAGTGACATTTGTGGACCAGGACGAGTTCTCTTTTGGTTCATGGGTTGATGTTTCCAAGAGAGAGATGCCAGCCCTGAGTACCGTCGCTCTAACTCGGGTGAAGATCGATCCAAGTATCCTATTCGGTGATCAAGAAACAGCGGATGACTACGAGAGACAAGTGGCAGAAATGTTGGAGAGAAATCGCCACCGAGATGTCTTCACTGATTACTCGTCCAGTAAAGAAATTCCCGGGCTGAAGAAGCGGATCTCTGCGTATGTGGACTTGAGTGTGAAGCCGTTTTGGATTCGGCCTCTGTTCTTCTGGATCGCCACCTTGTTGCAGATGACTTGGCCTTACCGCTGGCTGTTCAGAGCCAAGACAGCTAAGAGCTACTACGCCTTGAAGAAAAAGATGTACAAGAGTACAACACCGCCTATGGAGGTGGACGTGATGAATCCGATTGCAGTCCTGGCTGGAAATGCATCGTCAGTCCCCATTGGTCCAGACAACACCTGCCCAGGTTACCCAATGTCTGTGATAAACAATCCAGGAACAGGCAACCTGGCTTTCCAAAGTGGCAGCACACCATATCCACCCGTTAATCCATATCTCGGACAAAGCGATCCGGCCCATGGCATTAGCACCCCATACCCGCCATACAATCCAGAGGGCGAATCCTCACTTCTTCCTTATCCAGCGCCAGCACAGCCAAATGGTCCTCCGCCCTTGTACCCTGCAGGGATAAACAATCCAGCTACAGACAGCAGTACACCGTATCCACCGCTTAATCCATATACCGGACCTGCCTCTCCTCCTTATCCCGCCGGACCCCAGCCAAGTGCACCTCCACCTTCATACGAGGACGCTGTAGGCAACCCACCGCAGCCAAACAATGTAACATGA

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001151 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00008 all species →	EGF	EGF-like domain	Domain	Interproscan
PF14857 all species →	TMEM151	TMEM151 family	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000742 all species →	Domain	EGF-like domain	Interproscan
IPR026767 all species →	Family	Transmembrane protein 151	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR31893 all species →	TRANSMEMBRANE PROTEIN 151 HOMOLOG	Interproscan

Gene Ontology

No Gene Ontology signature was detected for evm.model.Ap8.890. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for evm.model.Ap8.890.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of evm.model.Ap8.890 across 49 RNA-seq samples of Astrangia poculata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

49Samples

1TPM > 0

4Conditions

89.1Max TPM

1.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
whole organism · cold control	14	1	6.36	89.06
whole organism · heat control	12	0	0.00	0.00
whole organism · cold challenge	12	0	0.00	0.00
whole organism · heat challenge	11	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR10674750	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	89.06
SRR10674714	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674715	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674724	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674733	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674734	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674735	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674736	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674737	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674739	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674743	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674746	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674747	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674748	whole organism · cold control	whole organism	not recorded	cold control	SRP237293	0.00
SRR10674706	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674707	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674708	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674717	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674718	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674720	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674721	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674725	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674731	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674741	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674752	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674753	whole organism · heat control	whole organism	not recorded	heat control	SRP237293	0.00
SRR10674711	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674712	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674713	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674722	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674723	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674730	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674732	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674738	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674740	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674744	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674745	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674749	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293	0.00
SRR10674709	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674710	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674716	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674719	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674726	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674727	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674728	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674729	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674742	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674751	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00
SRR10674754	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293	0.00

Source: CnidoSite RNA-seq expression matrices (APOCU_TPM, StringTie quantification over 49 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.