Gene detail

Detailed information of evm.model.Ap9.2406_evm.model.Ap9.2407.1.5f168d32 in Astrangia poculata

Genomic Location: Ap9:26042959...26056204
NR annotation: KAJ7372790.1, hypothetical protein OS493_016709 [Desmophyllum pertusum]
Species Astrangia poculata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

evm.model.Ap9.2406_evm.model.Ap9.2407.1.5f168d32

atgcctacgctatgcaaattaacatgtgtctttcctagtttggtaaatgatgcaatattcacactggaattattctttattgcagatggcgtttctcctgaattcagtgttcaagatttaaagggaaaaaaggttaattttgcatatcgtttatcggcaacaggtagagaaaatcgtggacggaaagatctcaaagaattttcaaatcaagatgaacttcaaccacttctggacactccgttagagaaaagcacttctataaacaatcatgatcatgtcaattctgacaatttagaattaagaatccctgaagaggaagataaatcagttatttcaagaacatctcaaaatgatcaaaatcaaccgttagtgttaaaaacttcagcaatgtcgagctttcatcaacaagatagaggtggtgaaaggtccacaatgaaaaactcaaacaattttccttcaacaaaaagtacagttcaccaagctagttccacaaataagattcctataacagaaaccttttctaatgagcatagaataagtattcatgacatacaaaaggttaaaccatcaaaagtatcctttaacaaaaattctttaatggagaaaatcttggtaacacaaagaactctgctgaaatcttcaagcaaagcagcggctccagaacaagtgatttcacaagatgaaaaaatctcctcaagaggaaataagcaatccagtatagtagataacaacacggcacaagtcgacaaaatcttgcctacaacaacacagtttttgactcaagatgttattaacagtattgcagaaaacatggaagtccgttttgaagttttggatgatatcaaaacagcagaaataacgttacggaataagggtttggcaccaattgagagagacaagtggtcggtacacttttgtatcacgaccggtatggagctcggccatcttgcgcacagaccagacgggtacgtattaccaggtgaaaaatcaataaaacttacgcacttcaacggatgcgcttataagctagagcccacgatagacttcaaggccatcctccctggaaactcgcttaaatttatggttcatatcggtccaacattagcccgatgtgacctggcgccgagatggtacgtcactgcagaaggccttgaaccgagggtcatttccaacactgccgatgagagcctggactttgtgttcctttcaaagacgaagaaaacctgggatagatttaagaataatgatgtggcagatcttgggaaggcacctctgctggtgattccaactcctttggaaattgtcgggttgaacgagtccaagaaattgtccattgatagcgaatgggtcgtgtttggagaatccggattggaagaggaaacaagcttcctcgcaggtaagctgcaattgcaaaaatcgctatctcaagcaaaggacagaaaatccatcaagctcacactaggtaaggtacaagtggtaatgcctgaagagaaacaacagcagttgtctaatgagtcatcttatgagtcttaccagcttaaggtgaatccctctgaacagttaatcacaatcacagggacaggaaaagctggggtgttctatggcgtccagactctcctctctctcatggacgaccaaggctcggttccacaggtgtcaatcaaagactctcctcgtttctcgtatcgcgggttgatggtggacgttgttcgtaacttttaccccaagcatgaaattctgaaacttttggacgtcatggcgatgtacaaaatgaacaagtttcattttcatctctcggataacgaaggatggaggctggaaataccaggaattgaagagctaacctcggttgggtccagaagatgtcatgacattcaagaaaagagatgcatcatgtctcaactcggttcaggcccctatacgaacacctcgggcactgggtactactccaccgaagactacagagaaatacttcttcacgcaacagcgcgtcacattcaagtgattccagagtttgactttccggggcacagtcacgcagctattaaaagcatgatagctcgccatgatagactgatgcaagaaggaaaagagagagacgctaaacaatttcttctaaatgactttaaggatgagtcgcggtatctttctgttcaaatgttcactgacgaaacttccagttgttgtttgaattcaacctacaatttaatggagtttatcttaaaaactttggtgagcctgcaccgcgatattcaacccctgaccgtttatcacttcggcggagacgaaattccagggggagcgtggcaaaaatcaccagcttgcgaacagttagccaagacattgaactttccttataacaacataaatacgcacaacaaactgaaacaatacttcttgcagcgtttaacgaatatcactgcaaaaatgaacctagctatcggtggctggggagattttttgttcgagcataaaacacggtcactcttttcaagggagttctttccaaataaggaagtgtattcatttgcatggagcataactggttttgcgaaaaataatcacgaggtatctttgatggctaacaatggatataaggttgtgctatcaagcccagacttcatctaccttgaccatccctacgaacccgactcagaggagcgcggaaagtactgggctacacgttatacggacacgcgcaaaatatttggcttcatgcctgaagacctctacgaagatatcgacaagatcccaaactgctctggcttgaagaagtgcgtggacggacggcaaaatgttctaggtgttgaggcagcggtctggggtgagacaataagaaccgctgaccacttgcaaagcatgatcttccctcgtcttcttgcactggcagaacgcgcttggcacaaagcaccttgggaaaacatccgggacaggggtgcacgagatcgcgagaagactggtgactgggtgaactttgctaacacgctgggttacaaggaactagctcggcttggtaagatgggcgtgacctatcatgtgacaccacctggagcaaggtttgtaggcaagaagctagaaacccgagctgtgctgcctggccttaaagttgaatactccactgatgatggagttacgtggaatgacgtcacgcctgacacggaggttgacgggaagataaagttgagaacgagatctactgatggtcaacgcgttagcagagaagttgagattgagccacccatgccggccgcaaaagcaaacaaagacaacattgtgtttcagccacaggccgagagaaaacaggaacaacaaattagagattga

Transcript

evm.model.Ap9.2406_evm.model.Ap9.2407.1.5f168d32

ATGCCTACGCTATGCAAATTAACATGTGTCTTTCCTAGTTTGGTAAATGATGCAATATTCACACTGGAATTATTCTTTATTGCAGATGGCGTTTCTCCTGAATTCAGTGTTCAAGATTTAAAGGGAAAAAAGGTTAATTTTGCATATCGTTTATCGGCAACAGGTAGAGAAAATCGTGGACGGAAAGATCTCAAAGAATTTTCAAATCAAGATGAACTTCAACCACTTCTGGACACTCCGTTAGAGAAAAGCACTTCTATAAACAATCATGATCATGTCAATTCTGACAATTTAGAATTAAGAATCCCTGAAGAGGAAGATAAATCAGTTATTTCAAGAACATCTCAAAATGATCAAAATCAACCGTTAGTGTTAAAAACTTCAGCAATGTCGAGCTTTCATCAACAAGATAGAGGTGGTGAAAGGTCCACAATGAAAAACTCAAACAATTTTCCTTCAACAAAAAGTACAGTTCACCAAGCTAGTTCCACAAATAAGATTCCTATAACAGAAACCTTTTCTAATGAGCATAGAATAAGTATTCATGACATACAAAAGGTTAAACCATCAAAAGTATCCTTTAACAAAAATTCTTTAATGGAGAAAATCTTGGTAACACAAAGAACTCTGCTGAAATCTTCAAGCAAAGCAGCGGCTCCAGAACAAGTGATTTCACAAGATGAAAAAATCTCCTCAAGAGGAAATAAGCAATCCAGTATAGTAGATAACAACACGGCACAAGTCGACAAAATCTTGCCTACAACAACACAGTTTTTGACTCAAGATGTTATTAACAGTATTGCAGAAAACATGGAAGTCCGTTTTGAAGTTTTGGATGATATCAAAACAGCAGAAATAACGTTACGGAATAAGGGTTTGGCACCAATTGAGAGAGACAAGTGGTCGGTACACTTTTGTATCACGACCGGTATGGAGCTCGGCCATCTTGCGCACAGACCAGACGGGTACGTATTACCAGGTGAAAAATCAATAAAACTTACGCACTTCAACGGATGCGCTTATAAGCTAGAGCCCACGATAGACTTCAAGGCCATCCTCCCTGGAAACTCGCTTAAATTTATGGTTCATATCGGTCCAACATTAGCCCGATGTGACCTGGCGCCGAGATGGTACGTCACTGCAGAAGGCCTTGAACCGAGGGTCATTTCCAACACTGCCGATGAGAGCCTGGACTTTGTGTTCCTTTCAAAGACGAAGAAAACCTGGGATAGATTTAAGAATAATGATGTGGCAGATCTTGGGAAGGCACCTCTGCTGGTGATTCCAACTCCTTTGGAAATTGTCGGGTTGAACGAGTCCAAGAAATTGTCCATTGATAGCGAATGGGTCGTGTTTGGAGAATCCGGATTGGAAGAGGAAACAAGCTTCCTCGCAGGTAAGCTGCAATTGCAAAAATCGCTATCTCAAGCAAAGGACAGAAAATCCATCAAGCTCACACTAGGTAAGGTACAAGTGGTAATGCCTGAAGAGAAACAACAGCAGTTGTCTAATGAGTCATCTTATGAGTCTTACCAGCTTAAGGTGAATCCCTCTGAACAGTTAATCACAATCACAGGGACAGGAAAAGCTGGGGTGTTCTATGGCGTCCAGACTCTCCTCTCTCTCATGGACGACCAAGGCTCGGTTCCACAGGTGTCAATCAAAGACTCTCCTCGTTTCTCGTATCGCGGGTTGATGGTGGACGTTGTTCGTAACTTTTACCCCAAGCATGAAATTCTGAAACTTTTGGACGTCATGGCGATGTACAAAATGAACAAGTTTCATTTTCATCTCTCGGATAACGAAGGATGGAGGCTGGAAATACCAGGAATTGAAGAGCTAACCTCGGTTGGGTCCAGAAGATGTCATGACATTCAAGAAAAGAGATGCATCATGTCTCAACTCGGTTCAGGCCCCTATACGAACACCTCGGGCACTGGGTACTACTCCACCGAAGACTACAGAGAAATACTTCTTCACGCAACAGCGCGTCACATTCAAGTGATTCCAGAGTTTGACTTTCCGGGGCACAGTCACGCAGCTATTAAAAGCATGATAGCTCGCCATGATAGACTGATGCAAGAAGGAAAAGAGAGAGACGCTAAACAATTTCTTCTAAATGACTTTAAGGATGAGTCGCGGTATCTTTCTGTTCAAATGTTCACTGACGAAACTTCCAGTTGTTGTTTGAATTCAACCTACAATTTAATGGAGTTTATCTTAAAAACTTTGGTGAGCCTGCACCGCGATATTCAACCCCTGACCGTTTATCACTTCGGCGGAGACGAAATTCCAGGGGGAGCGTGGCAAAAATCACCAGCTTGCGAACAGTTAGCCAAGACATTGAACTTTCCTTATAACAACATAAATACGCACAACAAACTGAAACAATACTTCTTGCAGCGTTTAACGAATATCACTGCAAAAATGAACCTAGCTATCGGTGGCTGGGGAGATTTTTTGTTCGAGCATAAAACACGGTCACTCTTTTCAAGGGAGTTCTTTCCAAATAAGGAAGTGTATTCATTTGCATGGAGCATAACTGGTTTTGCGAAAAATAATCACGAGGTATCTTTGATGGCTAACAATGGATATAAGGTTGTGCTATCAAGCCCAGACTTCATCTACCTTGACCATCCCTACGAACCCGACTCAGAGGAGCGCGGAAAGTACTGGGCTACACGTTATACGGACACGCGCAAAATATTTGGCTTCATGCCTGAAGACCTCTACGAAGATATCGACAAGATCCCAAACTGCTCTGGCTTGAAGAAGTGCGTGGACGGACGGCAAAATGTTCTAGGTGTTGAGGCAGCGGTCTGGGGTGAGACAATAAGAACCGCTGACCACTTGCAAAGCATGATCTTCCCTCGTCTTCTTGCACTGGCAGAACGCGCTTGGCACAAAGCACCTTGGGAAAACATCCGGGACAGGGGTGCACGAGATCGCGAGAAGACTGGTGACTGGGTGAACTTTGCTAACACGCTGGGTTACAAGGAACTAGCTCGGCTTGGTAAGATGGGCGTGACCTATCATGTGACACCACCTGGAGCAAGGTTTGTAGGCAAGAAGCTAGAAACCCGAGCTGTGCTGCCTGGCCTTAAAGTTGAATACTCCACTGATGATGGAGTTACGTGGAATGACGTCACGCCTGACACGGAGGTTGACGGGAAGATAAAGTTGAGAACGAGATCTACTGATGGTCAACGCGTTAGCAGAGAAGTTGAGATTGAGCCACCCATGCCGGCCGCAAAAGCAAACAAAGACAACATTGTGTTTCAGCCACAGGCCGAGAGAAAACAGGAACAACAAATTAGAGATTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q04786	Beta-hexosaminidase OS=Vibrio vulnificus OX=672 GN=hex PE=3 SV=1
Q54468	Chitobiase OS=Serratia marcescens OX=615 GN=chb PE=1 SV=1
P13670	N,N'-diacetylchitobiase OS=Vibrio harveyi OX=669 GN=chb PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000952 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02838 all species →	Glyco_hydro_20b	Glycosyl hydrolase family 20, domain 2	Domain	Interproscan
PF03173 all species →	CHB_HEX	Putative carbohydrate binding domain	Domain	Interproscan
PF00728 all species →	Glyco_hydro_20	Glycosyl hydrolase family 20, catalytic domain	Domain	Interproscan
PF03174 all species →	CHB_HEX_C	Chitobiase/beta-hexosaminidase C-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR015882 all species →	Domain	Beta-hexosaminidase, bacterial type, N-terminal	Interproscan
IPR004866 all species →	Domain	Chitobiase/beta-hexosaminidases, N-terminal domain	Interproscan
IPR008965 all species →	Homologous_superfamily	CBM2/CBM3, carbohydrate-binding domain superfamily	Interproscan
IPR004867 all species →	Domain	Chitobiase C-terminal domain	Interproscan
IPR012291 all species →	Homologous_superfamily	CBM2, carbohydrate-binding domain superfamily	Interproscan
IPR025705 all species →	Family	Beta-hexosaminidase	Interproscan
IPR014756 all species →	Homologous_superfamily	Immunoglobulin E-set	Interproscan
IPR017853 all species →	Homologous_superfamily	Glycoside hydrolase superfamily	Interproscan
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan
IPR015883 all species →	Domain	Glycoside hydrolase family 20, catalytic domain	Interproscan
IPR029018 all species →	Homologous_superfamily	Beta-hexosaminidase-like, domain 2	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR22600 all species →	BETA-HEXOSAMINIDASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0030246 all species →	Molecular Function	carbohydrate binding	Interproscan
GO:0004553 all species →	Molecular Function	hydrolase activity, hydrolyzing O-glycosyl compounds	Interproscan
GO:0030247 all species →	Molecular Function	polysaccharide binding	Interproscan
GO:0004563 all species →	Molecular Function	beta-N-acetylhexosaminidase activity	Interproscan
GO:0005975 all species →	Biological Process	carbohydrate metabolic process	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0030203 all species →	Biological Process	glycosaminoglycan metabolic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for evm.model.Ap9.2406_evm.model.Ap9.2407.1.5f168d32.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of evm.model.Ap9.2406_evm.model.Ap9.2407.1.5f168d32 across 49 RNA-seq samples of Astrangia poculata. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

49Samples

0TPM > 0

4Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole organism · cold control	14	0	0.00	0.00
whole organism · heat control	12	0	0.00	0.00
whole organism · cold challenge	12	0	0.00	0.00
whole organism · heat challenge	11	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR10674714	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674715	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674724	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674733	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674734	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674735	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674736	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674737	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674739	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674743	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674746	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674747	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674748	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674750	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674706	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674707	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674708	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674717	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674718	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674720	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674721	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674725	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674731	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674741	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674752	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674753	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674711	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674712	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674713	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674722	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674723	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674730	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674732	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674738	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674740	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674744	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674745	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674749	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674709	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674710	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674716	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674719	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674726	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674727	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674728	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674729	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674742	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674751	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674754	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293

Source: CnidoSite RNA-seq expression matrices (APOCU_TPM, StringTie quantification over 49 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.