Gene detail

Detailed information of evm.model.Ap9.2469 in Astrangia poculata

Genomic Location: Ap9:26651007...26665042
NR annotation: XP_020619362.1, angiopoietin-1 receptor-like [Orbicella faveolata]
Species Astrangia poculata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

evm.model.Ap9.2469

atgatagacttgttttgccgctatcatttcccgccatgtgatacgtcacttgccagtcctcaagcccgcgggatttgccgcaggtcttgcgtacacttggaccaagatctgtgcaaggaagaaatgattttggtcaggcaggcagcggaagcagctccagtgctggatgaagatatgatagattgcacattgtacgacatggccaatggaggtgatgcccctgaatgttatcaataccattctataccaggcgatgatacaaagagcacagactgttaccatggcatcggagttggttaccgcggcaacgtaaacatcaccgagtctggtcgtacttgtcaggcatggacctcacaatgtcctcatcgtcactggaggattcctaaagatgtcgctgatgagcagaatgatttcaacatgtgtcgtaacccggatagcagttccccgagtggaccttggtgctataccactgacccaaatgttcgatgggaatactgcaacgtgtcgcgatgccctccaagagtacctgaggaatctcctacgttcctaaaaggctatcctctcaattcaactgccattcatgtgtcctggaaaagcctccctccatcccgtcataaagaacaactgctgggctatcgggtaaaatacagacggctcagatcacaggtgtataaagaaattagtatcacaagcaacttcacagagacggtcattacaagacttgatgcacaaacggtatacgagattgaagtcaatggatttaacgaaattggtcatgggccatttagcaagatcctcgtagtgaaaactgcttcgtctggtgaggtcactgttggtctaaattttcagttggtgatagatacagactttaacacagatcttctgaaccgaagtagtaacaagtttatgacaatggaagacaacattaaaatggcgataaaacgtcatttcaataaatcatccatttttaggatctacgacgtcagagtttttaggttcagcatgggaagtgtgcaggccgacgtccaggtcttagccgtaataaatacaaacacgacaggaaaggttgaagccctaaatcatttagtcgaaggacttgactctgcagtggggaaagtacttaatgtcactactgtaagagttctagaaaaacctcaatccccagaagacttgaaagtcacaaatgttcagacaaggtacatggttctaacctggaatcaaccaaaatatggcagtttatacagaatacaaaactacaccatcgagcgaaaagatgattccttggatgacttcatggtgatacagacactgccatactctcagacagcggcgatgatgaacgatttagaaccctcgacaaagtacactgttcgagtgtcaagcaacaacaaatatggaagatcagatggtgttttgataacacaaggcacactacctgacaggttcatccgggatctggtgctgattatcgtgttaccgctgaccttagctgttttgtttattgtgattgtttgcgtaaaagttcgaccaacttgtaaatcaaaaccagagaaatataagacgcagcttttgatgcgtttcacgggaggagattggcgtgaattacccacatcagatattcaacttcaagagaagttaggagaaggcgcgtttggcgaagcttataaaggtttggtacggacgaacgggcaatggcaaaactgcgcagtgaaaaagcttaaagagaatgccacagagagggagagacgggacttgatgaacgagctacaaatcatggtcacagttggtgaacatcctaacgtcataagtcttattggagcttgtacaagaagcggcccaatattggtggtagttcgcttggctgagaatggttccttgttaaatcatttgaagaaaaacaggaaaaacccttatgctaacctccaagagaataattttactcacatcgacgaattaaggatctcaagagacattgcgaatggaatgttgcacctcgccagcaaaaagtgtgtgcatcgtgatcttgcagcacgaaacgttcttcttggcgagaacaatgttgccatgatttctgactttggcatgtcaagggatgtgtacgaaagtggtgaatacgagcaaatgtccgggggattgatgcctgttcgttggatggccatcgagtcgttggaggattatacattcaatatcttgacagatgtatggtcatttggtgtcgtgttgtgggagatacagtctggaggtaaaatgccgtgttccggacttggaggtatggaggttgtagaatttgtcaaatcaggggaaagattaaagaaaccagatggatgtccagaagaaatttacgagatcatgatgtcatgctggcgtccagacccctcacaacgcccgtcatttagcgagctcgtgacatcactggagcagctgttaaaaaagaaaggagattctctgaaggacaaaacatttgcagccgagtctcaagggaacgtgaatttggcagtggaagttgcaactaattaa

Transcript

evm.model.Ap9.2469

ATGATAGACTTGTTTTGCCGCTATCATTTCCCGCCATGTGATACGTCACTTGCCAGTCCTCAAGCCCGCGGGATTTGCCGCAGGTCTTGCGTACACTTGGACCAAGATCTGTGCAAGGAAGAAATGATTTTGGTCAGGCAGGCAGCGGAAGCAGCTCCAGTGCTGGATGAAGATATGATAGATTGCACATTGTACGACATGGCCAATGGAGGTGATGCCCCTGAATGTTATCAATACCATTCTATACCAGGCGATGATACAAAGAGCACAGACTGTTACCATGGCATCGGAGTTGGTTACCGCGGCAACGTAAACATCACCGAGTCTGGTCGTACTTGTCAGGCATGGACCTCACAATGTCCTCATCGTCACTGGAGGATTCCTAAAGATGTCGCTGATGAGCAGAATGATTTCAACATGTGTCGTAACCCGGATAGCAGTTCCCCGAGTGGACCTTGGTGCTATACCACTGACCCAAATGTTCGATGGGAATACTGCAACGTGTCGCGATGCCCTCCAAGAGTACCTGAGGAATCTCCTACGTTCCTAAAAGGCTATCCTCTCAATTCAACTGCCATTCATGTGTCCTGGAAAAGCCTCCCTCCATCCCGTCATAAAGAACAACTGCTGGGCTATCGGGTAAAATACAGACGGCTCAGATCACAGGTGTATAAAGAAATTAGTATCACAAGCAACTTCACAGAGACGGTCATTACAAGACTTGATGCACAAACGGTATACGAGATTGAAGTCAATGGATTTAACGAAATTGGTCATGGGCCATTTAGCAAGATCCTCGTAGTGAAAACTGCTTCGTCTGGTGAGGTCACTGTTGGTCTAAATTTTCAGTTGGTGATAGATACAGACTTTAACACAGATCTTCTGAACCGAAGTAGTAACAAGTTTATGACAATGGAAGACAACATTAAAATGGCGATAAAACGTCATTTCAATAAATCATCCATTTTTAGGATCTACGACGTCAGAGTTTTTAGGTTCAGCATGGGAAGTGTGCAGGCCGACGTCCAGGTCTTAGCCGTAATAAATACAAACACGACAGGAAAGGTTGAAGCCCTAAATCATTTAGTCGAAGGACTTGACTCTGCAGTGGGGAAAGTACTTAATGTCACTACTGTAAGAGTTCTAGAAAAACCTCAATCCCCAGAAGACTTGAAAGTCACAAATGTTCAGACAAGGTACATGGTTCTAACCTGGAATCAACCAAAATATGGCAGTTTATACAGAATACAAAACTACACCATCGAGCGAAAAGATGATTCCTTGGATGACTTCATGGTGATACAGACACTGCCATACTCTCAGACAGCGGCGATGATGAACGATTTAGAACCCTCGACAAAGTACACTGTTCGAGTGTCAAGCAACAACAAATATGGAAGATCAGATGGTGTTTTGATAACACAAGGCACACTACCTGACAGGTTCATCCGGGATCTGGTGCTGATTATCGTGTTACCGCTGACCTTAGCTGTTTTGTTTATTGTGATTGTTTGCGTAAAAGTTCGACCAACTTGTAAATCAAAACCAGAGAAATATAAGACGCAGCTTTTGATGCGTTTCACGGGAGGAGATTGGCGTGAATTACCCACATCAGATATTCAACTTCAAGAGAAGTTAGGAGAAGGCGCGTTTGGCGAAGCTTATAAAGGTTTGGTACGGACGAACGGGCAATGGCAAAACTGCGCAGTGAAAAAGCTTAAAGAGAATGCCACAGAGAGGGAGAGACGGGACTTGATGAACGAGCTACAAATCATGGTCACAGTTGGTGAACATCCTAACGTCATAAGTCTTATTGGAGCTTGTACAAGAAGCGGCCCAATATTGGTGGTAGTTCGCTTGGCTGAGAATGGTTCCTTGTTAAATCATTTGAAGAAAAACAGGAAAAACCCTTATGCTAACCTCCAAGAGAATAATTTTACTCACATCGACGAATTAAGGATCTCAAGAGACATTGCGAATGGAATGTTGCACCTCGCCAGCAAAAAGTGTGTGCATCGTGATCTTGCAGCACGAAACGTTCTTCTTGGCGAGAACAATGTTGCCATGATTTCTGACTTTGGCATGTCAAGGGATGTGTACGAAAGTGGTGAATACGAGCAAATGTCCGGGGGATTGATGCCTGTTCGTTGGATGGCCATCGAGTCGTTGGAGGATTATACATTCAATATCTTGACAGATGTATGGTCATTTGGTGTCGTGTTGTGGGAGATACAGTCTGGAGGTAAAATGCCGTGTTCCGGACTTGGAGGTATGGAGGTTGTAGAATTTGTCAAATCAGGGGAAAGATTAAAGAAACCAGATGGATGTCCAGAAGAAATTTACGAGATCATGATGTCATGCTGGCGTCCAGACCCCTCACAACGCCCGTCATTTAGCGAGCTCGTGACATCACTGGAGCAGCTGTTAAAAAAGAAAGGAGATTCTCTGAAGGACAAAACATTTGCAGCCGAGTCTCAAGGGAACGTGAATTTGGCAGTGGAAGTTGCAACTAATTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q02763	Angiopoietin-1 receptor OS=Homo sapiens OX=9606 GN=TEK PE=1 SV=2
Q06807	Angiopoietin-1 receptor OS=Bos taurus OX=9913 GN=TEK PE=2 SV=1
Q02858	Angiopoietin-1 receptor OS=Mus musculus OX=10090 GN=Tek PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000396 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00051 all species →	Kringle	Kringle domain	Domain	Interproscan
PF00041 all species →	fn3	Fibronectin type III domain	Domain	Interproscan
PF07714 all species →	PK_Tyr_Ser-Thr	Protein tyrosine and serine/threonine kinase	Domain	Interproscan
PF01390 all species →	SEA	SEA domain	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036790 all species →	Homologous_superfamily	Frizzled cysteine-rich domain superfamily	Interproscan
IPR000001 all species →	Domain	Kringle	Interproscan
IPR013806 all species →	Homologous_superfamily	Kringle-like fold	Interproscan
IPR038178 all species →	Homologous_superfamily	Kringle superfamily	Interproscan
IPR003961 all species →	Domain	Fibronectin type III	Interproscan
IPR000719 all species →	Domain	Protein kinase domain	Interproscan
IPR036364 all species →	Homologous_superfamily	SEA domain superfamily	Interproscan
IPR000082 all species →	Domain	SEA domain	Interproscan
IPR020067 all species →	Domain	Frizzled domain	Interproscan
IPR020635 all species →	Domain	Tyrosine-protein kinase, catalytic domain	Interproscan
IPR011009 all species →	Homologous_superfamily	Protein kinase-like domain superfamily	Interproscan
IPR036116 all species →	Homologous_superfamily	Fibronectin type III superfamily	Interproscan
IPR001245 all species →	Domain	Serine-threonine/tyrosine-protein kinase, catalytic domain	Interproscan
IPR017441 all species →	Binding_site	Protein kinase, ATP binding site	Interproscan
IPR050122 all species →	Family	Receptor Tyrosine Kinase	Interproscan
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan
IPR008266 all species →	Active_site	Tyrosine-protein kinase, active site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24416 all species →	TYROSINE-PROTEIN KINASE RECEPTOR	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0004672 all species →	Molecular Function	protein kinase activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0006468 all species →	Biological Process	protein phosphorylation	Interproscan
GO:0004713 all species →	Molecular Function	protein tyrosine kinase activity	Interproscan
GO:0004714 all species →	Molecular Function	transmembrane receptor protein tyrosine kinase activity	Interproscan
GO:0005887 all species →	Cellular Component	plasma membrane	Interproscan
GO:0007169 all species →	Biological Process	cell surface receptor protein tyrosine kinase signaling pathway	Interproscan
GO:0007275 all species →	Biological Process	multicellular organism development	Interproscan
GO:0033674 all species →	Biological Process	positive regulation of kinase activity	Interproscan
GO:0043235 all species →	Cellular Component	receptor complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for evm.model.Ap9.2469.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of evm.model.Ap9.2469 across 49 RNA-seq samples of Astrangia poculata. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

49Samples

0TPM > 0

4Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole organism · cold control	14	0	0.00	0.00
whole organism · heat control	12	0	0.00	0.00
whole organism · cold challenge	12	0	0.00	0.00
whole organism · heat challenge	11	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR10674714	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674715	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674724	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674733	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674734	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674735	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674736	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674737	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674739	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674743	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674746	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674747	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674748	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674750	whole organism · cold control	whole organism	not recorded	cold control	SRP237293
SRR10674706	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674707	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674708	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674717	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674718	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674720	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674721	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674725	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674731	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674741	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674752	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674753	whole organism · heat control	whole organism	not recorded	heat control	SRP237293
SRR10674711	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674712	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674713	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674722	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674723	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674730	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674732	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674738	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674740	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674744	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674745	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674749	whole organism · cold challenge	whole organism	not recorded	cold challenge	SRP237293
SRR10674709	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674710	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674716	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674719	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674726	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674727	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674728	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674729	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674742	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674751	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293
SRR10674754	whole organism · heat challenge	whole organism	not recorded	heat challenge	SRP237293

Source: CnidoSite RNA-seq expression matrices (APOCU_TPM, StringTie quantification over 49 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.